header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9606
Transcript Name: aldh8a1-201
Previous Name: aldh8a1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027017 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027017|OTTDARG00000021285|ZDB-GENE-040912-3 aldh8a1|OTTDARP00000022143 aldh8a1-001 LG_ BX927365.7 Danio rerio protein_coding KNOWN, 1690 bp
AACATATTGCAAAAGAGTCTGGCGAAAGCTCATATGCAAC
ACCGTGCTGAGTGCAGCGCAAAACTTTCAGATCCTCCTTT
TGTTTGCCAAGCTTGATTTTTTTTTTTATCTCAATTTTTT
TTGCGATGTCAAAAGACATGAAATATCTAGTGCTGGAAAA
CTACATCGGTGGGAAGTTTGTGCCATGTTCCAAGCTGATC
GACTCTTTCGACCCGTCAACAGGAGAAGTTTATTGCAAAG
TTCCAGACAGTGGAGCTGAAGAGGTGAATGCTGCAGTGAG
GGCAGCTAAAGAGGCCTTTCCGGATTGGTCGGCTAAAAGC
CCAGCTGATAGATCCAAAGTGCTGAATAAACTGGCAGACC
TGATAGAGGCTCGACTGGAGGAGTTTGTTCAGGCCGAGTC
TAAAGACCAGGGAAAGACTATCACTTTTGCCCGAAATGTG
GACATTCCCCGATCAGCATACAACTTCCGTTTTTTTGCTT
CATCCGTCCTGCATCACACTAATGACTGCAGTCAGATGGA
TCACATGGGCTGTCTCAATTATACAATCCGCTGTCCTGTA
GGAGTGGCTGGTCTGATAAGCCCATGGAATCTGCCACTGT
ACCTCCTAACCTGGAAAATCGCCCCGGCTGTTGCTACGGG
TAATACTGTTGTGGCAAAACCCAGTGAAATGACTTCAGTT
ACCGCCTGGATGATGTGTCAGCTGTTAGAGGAAGCTGGCT
TTCCACCAGGAGTGGTCAACATAGTCTTTGGGACAGGTCC
TCGTGCAGGTGATGCTTTGGTTTCTCACCCTGATGTACCC
TTGATCTCATTTACGGGTAGCACGGCTACAGCGAGACTGA
TCACTGAACGCAGTGCACCGCACTGTAAGAAGCTTTCACT
GGAACTTGGTGGGAAAAACCCGGCAATTATATTTGCTGAT
GCAGACATGGAGCAATGCATCAGCACTACTGTACGCTCCA
GCTTCTCCAATCAGGGTGAGATCTGCCTGTGTACCAGCCG
CATCTTTGTGGAGCGGAGCGTTTACCCAGAATTCCTCACT
CGTTTTGTGGAGGCGACTCGTCGGTGGAAAACCGGGGTTC
CTTCAGACCCCTCAAATGACAATGGAGCACTCATTAGCAA
AGAACATCTGCAGAAGGTCAAAGGTTACATTACGTTGGCC
CTTGCGGAGGGTGCACAGGTGCATTGTGGAGAAGGTGTGG
ACAAACTTGCCCTTCCACAGCAAAACATCGGTGGTTACTT
CATGTTGCCCACCATCATCTCCGGAGTCAAAGATTCCTCC
GCACTGATGCAGGAAGAGATTTTCGGTCCCGTAACCTGCG
TGACGCCCTTCGATGAAGAAGAGGAAGTGATATCACGAGC
AAACAATGTCCGCTATGGTTTGTCTGCCACAGTCTGGTCC
CGAGATGTCGGGCGCGTGCACAGGGTTGCTAGGAAACTGC
AGGCTGGGTTAGTGTGGACCAATTGCTGGCTGGTCAGAGA
TTTAAACCTGCCGTTTGGTGGCATGAAGCACTCTGGGATT
GGTCGAGAGGGGGGGAAAGACTCCTACCACTTCTTCACTG
AGGTTAAATCTGTAACTGTCAAACACTGACATGGATGAAG
CGGTGATAGTGAGTCATGTGTCACTCGAAATTATATAGAG
GAAGCAATCAGGGTTGTTATGATTGCGAATAAAGTTTATG
AGGAAATCAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aldh8a1-201 Contained in:
[BAC] DKEY-161P7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027017 (1),  Ensembl_Trans:ENSDART00000053399 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC081581 (1) 1673 bp
GenBank:DN599191 (1) 841 bp
CITATIONS (2)