header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9602
Transcript Name: slc2a12-202
Previous Name: slc2a12-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027013 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027013|OTTDARG00000021283|ZDB-GENE-040426-1513 slc2a12|OTTDARP00000022140 slc2a12-002 LG_ BX927365.7 Danio rerio protein_coding KNOWN, 840 bp
ACGCTGACCCTGTGTGTCAATGATCTTAATAGCTGCAAAT
GCTTTTACTTGTTGATCTGCGCCAAGAGAAATGGCACTGA
GAAATCCAAGATGTTGCACCACAACGCTTGAAGAACATGG
ATGCACCTGAGGAATCAATAAGGATGACGTCTGATCCCCA
GAGCAAAATATATGTGCAGAATCCAGACACACACATACAT
CTAGAGCAAGGCCCATCTGCAAAATCAGGCAATGGCAGAG
CTCTGGTCCTGTGCTCTGTGTCTGTGGCCTGCCTGAGTGG
CTTGCTGATGGGATACGAGATGAGTCTGATATCTGGAGCT
TTGCTTCAACTCAGGGACGTTTTGACTCTCTCCTGCCCGG
AGCAAGAGCAGGTCGTCGGCTCTCTTCTGCTTGGAGCCTT
CCTCCTGTCCCTGGGTGGTGGGACAATCCTGGACCACTAC
GGACGACGCTTCACCATCATCCTCACTGCTCTGTTGTGTG
TGTTGGGAACTCTTCTGAGTGTGTGTGTGGTGTCATTTTG
GGCACTAGTGGTCGGGAGAATGCTGGTTGGGATGTCAGTG
GCGCTGTCAGGCACAGCGTCTTGTTTGTATGCAGCAGAAG
TGGCACCAGCCGCCTGGCGCGGGAGGTGCGTGTGTGTGTA
TGAGTTAATGGTGGTTTTAGGGATGCTGTTGGGTTTTGGA
CTGAGCTGGGCGTTCGCTGGGGTTCCGGATGGATGGAGGT
TTACATTTGGTGGCGCGCTGCTTCCCGCTTTACTGCAAGC
TGGGGTTATGCCACTTTTGCCAGACAGTCCACGCTTTTTG
CTCGCCCAGCAGCGCGAAAAGGAAGCTCATGCCACTCTGC

slc2a12 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc2a12-201 (1)    Ensembl 2401
slc2a12-202 840
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc2a12-202 Contained in:
[BAC] DKEY-161P7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027013 (1),  Ensembl_Trans:ENSDART00000143335 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK238030 (1) 861 bp
GenBank:CB358625 (1) 519 bp
CITATIONS (2)