ZFIN ID: ZDB-TSCRIPT-090929-9601
Transcript Name: slc2a12-201
Previous Name: slc2a12-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027012 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027012|OTTDARG00000021283|ZDB-GENE-040426-1513 slc2a12|OTTDARP00000022139 slc2a12-001 LG_ BX927365.7 Danio rerio protein_coding KNOWN, 2401 bp
CAAGGACAGACAAGTTACAGGCACCAGGGAGGAGAGAGTC
AAAAAGCTGCGATGATTTCATAGACAACATTCCCCTTCAC
TGACGCTAAAGAGTTGCACCACAACGCTTGAAGAACATGG
ATGCACCTGAGGAATCAATAAGGATGACGTCTGATCCCCA
GAGCAAAATATATGTGCAGAATCCAGACACACACATACAT
CTAGAGCAAGGCCCATCTGCAAAATCAGGCAATGGCAGAG
CTCTGGTCCTGTGCTCTGTGTCTGTGGCCTGCCTGAGTGG
CTTGCTGATGGGATACGAGATGAGTCTGATATCTGGAGCT
TTGCTTCAACTCAGGGACGTTTTGACTCTCTCCTGCCCGG
AGCAAGAGCAGGTCGTCGGCTCTCTTCTGCTTGGAGCCTT
CCTCCTGTCCCTGGGTGGTGGGACAATCCTGGACCACTAC
GGACGACGCTTCACCATCATCCTCACTGCTCTGTTGTGTG
TGTTGGGAACTCTTCTGAGTGTGTGTGTGGTGTCATTTTG
GGCACTAGTGGTCGGGAGAATGCTGGTTGGGATGTCAGTG
GCGCTGTCAGGCACAGCGTCTTGTTTGTATGCAGCAGAAG
TGGCACCAGCCGCCTGGCGCGGGAGGTGCGTGTGTGTGTA
TGAGTTAATGGTGGTTTTAGGGATGCTGTTGGGTTTTGGA
CTGAGCTGGGCGTTCGCTGGGGTTCCGGATGGATGGAGGT
TTACATTTGGTGGCGCGCTGCTTCCCGCTTTACTGCAAGC
TGGGGTTATGCCACTTTTGCCAGACAGTCCACGCTTTTTG
CTCGCCCAGCAGCGCGAAAAGGAAGCTCATGCCACTCTGC
TTCGACTTCGTGCTGGGATCAAAGAAGTCGAGCCAGTGGA
GGATGAGCTCCGGGCGATCCGTTTGGCAATGGGCGCAGAG
CGTCTTCATGGCTTCCTGGACCTCTTCCAATCCCGGGACA
ACATGCTTCAGAGGCTTCTTGTTGGCGCTGCGCTGGTGTT
CTTGCAGCAGGCCACAGGACAGCCTAATATTTTAGCATAT
GCCTCGACTGTTCTCAGTAGCGTAGGCTTTCATGGGAATG
AGGCGGCGACTCTTGCGTCTACAGGGTTTGGTGTGGTTAA
AGTGGGTGGAACCATTCCTGCAATTTTTCTAGTGGACAAA
GTTGGGCCTAAAGCCCTTCTGTGTGTTGGAGTGGTTGTCA
TGATGTTGTCAACAGCAACGCTGGGGGCCATTACTATGCA
GAGCCGCACACACGTTTCCAGCCTATGCAGAGGCCCCGGT
AATACAGCAAACTTCACGTTATTTGAGACCGGAGATGAGA
CTGATATCCAGACCAACACTCCACTGGGCTTATACCAGCC
TCAAAACAAGCTCAAAACAAACACTTTTCTCACAAGCATT
AATGACACTAGAGAGCATTGGATTTTAAATCACACCTATA
ATCATAGGACTGCTTTAATGGAAACCGCTGAGCTTTCGAA
GAAAGACAGTGCAAAGATTGCGCTTCAGTCTCTTCACGAA
GTGTCGCCTTCGCTGAAATGGATCTCTCTGGTCAGCCTGC
TGGTGTATGTAGCTGGATTCTCCATCAGCTTGGGACCAAT
GGTTCATGTTGTTTTAAGTGCAATCTTTCCTACTGGCATC
CGGGGGAAGGCTGTATCTGTCATCTCCGCCTTTAACTGGG
CCACAAATTTGCTCATATCGATGACCTTCCTTACCCTGAC
AGAGCGGATCGGCCTCCCTACTGTCATCTTCTCCTACTCT
GCTATGAGCTTCCTGTTGGTGGTGTTTGTGATTGTGTTTG
TGCCAGAGACCAAAGGCCGATCATTGGAACAGATCTCAAA
GGAACTTGCAATGAAGAATCACCTGAGAGGCACATTGCTG
TGTCACAGAAGAAAACACAAAGCTACAGCACAGCCCTCAC
AGGAGGAAAAAGCCCTCGCAACAGTTTGACTTTTTACCTA
GATGAAGAGTGAAAGAGCAACTGATCAGACAGCTGAACCT
GTGACTGCACCAATCAGAGAATTGAAGATATCTGCCTGAT
TTATGTTGTGCTTTCCCCATTTAAGAAAAATGTAACATGC
CAATCTGATTCATTGTATTCTTCATGTATTTTAAGTAATT
CTGGATTTATATGGAGCTTTTACTACTCACTGTTATGAAA
CTCTGGAAGGAAACTGTGCAATCATTAGCATAATCATGCC
ATGGCATGTCCAAGGCAAGTTCTGTGGCAAAGTCACATAT
CAGTGTTTGTGTGCTGAACATTACCATAAATAACAGTTTA
AAGTATGGCATGAGATGCCTTGTATAATCATGTTACACAA
TTGTGAATCAACATGTTATGTAATATTTCAAAATTATATT
GTTGGTTGTTCATAAAAGTTGTCCGAATGGTTTTGACCAG
A

slc2a12 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc2a12-201 2401
slc2a12-202 (1)    Ensembl 840
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc2a12-201 Contained in:
[BAC] DKEY-161P7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027012 (1),  Ensembl_Trans:ENSDART00000053531 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC056306 (1) 2386 bp
GenBank:BC067616 (1) 2370 bp
GenBank:CK236480 (1) 855 bp
CITATIONS (2)