header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9600
Transcript Name: myb-201
Previous Names: cmyb-002, myb-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027011 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027011|OTTDARG00000021282|ZDB-GENE-991110-14 myb|OTTDARP00000022138 cmyb-002 LG_none BX927365.7,CT573377.14 Danio rerio protein_coding KNOWN, 2085 bp
CAGCACTTCCTCCTCGAAGAGGAGCTGACAGCACTCCACC
TTAGCACACTTGAGCCGAGCGCACTCACCATCACATCTCT
ACCTTCCTCTCGAACAGCGGGATGGCGAGGCGGCACAGAC
ACAGTGTTTACAGTAGCGACGAAGATGATGATGATGTGGA
GATTTATGATCATGACTATGATGGTCCTCATGCCAAGACA
GGAAAACGCCACCTCGGCAAGACACGCTGGACCCGTGAGG
AGGATGAAAAGTTAAAGAGGCTGGTAGAGCATCATGGTTC
TGAAGACTGGAAAGTCATCGCCAGCTTTCTACCGAATCGA
ACAGATGTTCAATGCCAGCATCGTTGGCAGAAAGTCCTCA
ACCCTGAACTCATTAAAGGACCATGGACTAAAGAAGAAGA
CCAACGGGTGATTGAGTTGGTGCAGAAGTACGGCCCCAAA
CGTTGGTCAGTAATCGCAAAGCATTTAAAGGGGCGAATCG
GAAAGCAGTGTAGAGAGCGCTGGCACAACCATCTAAACCC
TGAGGTGAAGAAGACGTCCTGGACTGAGGAAGAAGATCAA
ATCATTTACCAGGCGCACGAGAAACTTGGAAACCGATGGG
CCGAGATTGCCAAGTTACTTCCGGGAAGAACCGATAATGC
CATCAAGAATCACTGGAACTCCACTATGCGGCGGAAAGTG
GAGCAAGAAGGTTATTTGCAGCACGCTGCTAAAGTCAGCC
CAACTCCGCTAAACAACAGCTATTCTAAACCTCACCTCCT
GAACTACAATCACACACCAAGCAACACATCCATGCCTGCC
TCCTCCATGAGCAATCAGTATCCATACTACACTGAATCAT
CACGGGTGCCATTTCCACTTGCTCTCCAGTTAAACATCTT
GAACTTTCCACAACATGGCACTGCTGCTATCCAGAGACAC
TACAGCGACGAGGACCCCGAAAAAGAAAAGAGGGTGAAAG
AAATCGAGATGCTGTTGATGTCAACAGAAAACGAGCTGAA
GGGACAACAGGCACTACCAATCTCCATGAACGGCTACGGT
GGCTGGAACAGAGGCTCTTTGGCGGACAGTTCGGTTGGCA
TTGTTGTTTCAGTCCCGGCTCCATCCCTAGAGCAAGGATG
CCTTCCTGAAGAAAGCGCACATGGCAACACAAACAGCCCA
AATAACGACTCCAGCTCCACTTTACCAGAGTTTATCGATG
CTATTGATTCGTTCTTTAATGCTTCAGTGAGTCCCGATTC
AGACAGTCAAAATATACCAGTCACGCCATCGCCGGTCTGC
TCCCAGAAAGCACTGCAGCAAGACCTTGCTCTTCGACCTC
AGAAGGAAAATGAGCTGTTCCGAACTCCCAACCTGAGGCG
TTCGATCATGGAGTGTTCTCCTCGCACACCCACTCCATTC
AAATCCACACTGACAATGCAGGACAGCAAATACGGACCAC
TGAAGAGGGTCCACAGTCCTTCGCTGGACTCTGGAGTGGT
CGGCACGATTAAACAAGAGCCCCAGGAGTGTGAGATCAGT
GTTGGAGGGGTGCATCTAGACCAGCCCCCTCTGAAAAAGA
TCAAACAGGAGGTGGAGTCAGTGTGTCTTCAGTGGGAGGG
GCAAGATCTCCACACTCAGCTGTTCCCTTCTAATGGCCCC
GCCCACGACATGCCTGATCTGCTGACTAGCTCTGTGCTGA
TGCTTCCCAACACAGAGAAGACTGAGGACGGACACAAAGC
TGCCCAGTTGCCCCGCAGACCCATAGGAAGTCCTTTGCAG
CAGTTGAACACATGGGAACAGGTGCTTTGTGGGAAGACGG
AAGAGCAGACGATTCCCTCTGAAGCCACGCACAAATACCT
CAGCAATTATTCTTCGCGAGCTCTGGTCATATGAACGAGA
GACATAATGAGACAAAAATAGAAAGGGAAGGAGGAGGGAG
AGTGAAAGAAGACAATCATTCTGAAAAGAAGTAAAAAGAG
GAACAGTCCCTACACTCGTGGTACATTATTTGGGAGAGGC
TGTAAGCCATTTTTGTTTGTAGACTGCACAGTCGATGTTT
GGTCGCCAATGTTTAAGCTGTGCCATCATTCAAGGAACCA
AAGAC

myb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA myb-201 2085
myb-202 (1) 3317
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myb-201 Contained in:

OTHER myb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027011 (1)
  • Ensembl_Trans:ENSDART00000075726 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF191559 (1) 2085 bp
    GenBank:CK694831 (1) 739 bp
    GenBank:CD600242 (1) 500 bp
    CITATIONS (2)