header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9598
Transcript Name: sgk1-004
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027009 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027009|OTTDARG00000021281|ZDB-GENE-030131-2860 sgk1|no_translation sgk-004 LG_ BX927365.7 Danio rerio protein_coding KNOWN, 649 bp
GGGCCCAGAGTGGAAAACTACAGCCATGACAATCCAAACG
GAGACGAGCGTTTCAGCTCCAGACTTGACCTACTCTAAAA
CAAGAGGACTAGTAGCTAATCTGAGTGCTTTTATGAAGCA
GAGAAAGATGGGACTGAATGACTTCATCCAGAAGCTTTCT
GCAAACTCCTATGCATGCAAGCATCCTGAGGTTCAGTCCA
TCCTAAACCTGACACCACCACAAGATGTGGAGCTAATGAA
CAGCAACCCTTCCCCTCCGCCAAGTCCCTCTCAGCAGATC
AACCTCGGCCCTTCCTCAAACCCCACCGCCAAACCATCAG
ACTTCGACTTTCTGAAAGTCATCGGAAAGGGTAGCTTCGG
CAAGGTTCTCCTGGCACGACACCGGAGCGATGAGAAGTTT
TATGCTGTGAAGGTGCTTCAGAAGAAAGCCATCTTAAAGA
AAAAAGAGGTATGAGATCACACACGCACACAGCTATTCAC
TTAAGCTTTTTGTCAATCAGTAAGTATGCATGACCTCTTA
ACCTCTGACCCTTAGGAGAAACACATTATGTCAGAGCGCA
ATGTGTTACTGAAGAATGTCAAGCATCCATTCCTTGTGGG
CCTGCATTACTCTTTCCAGACCACTGATAAACTCTACTTC
GTACTGGAC

sgk1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sgk1-201 (1)    Ensembl 2320
sgk1-202 (1)    Ensembl 845
sgk1-203 (1)    Ensembl 799
sgk1-204 (1)    Ensembl 1143
ncRNA sgk1-004 649
sgk1-006 (1)    Ensembl 844
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sgk1-004 Contained in:
[BAC] DKEY-161P7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027009 (1),  Ensembl_Trans:ENSDART00000148122 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD599436 (1) 650 bp
CITATIONS (2)