ZFIN ID: ZDB-TSCRIPT-090929-9583
Transcript Name: tuba1b-201
Previous Names: tuba1-001, tuba1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026993 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026993|OTTDARG00000021280|ZDB-GENE-030822-1 tuba1b|OTTDARP00000022124 tuba1-001 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 1588 bp
ACTTCATTCTCTCACCAGACTCATAAAAGTCGAGTGTGAG
AGCGTTTATAACAGAAAAACCGAAGGCTATCCTATTCATA
ATTGCCATTCATCGAAAATACACATTTGAAAATGCGTGAG
TGCATCTCTATCCACGTTGGTCAGGCTGGAGTTCAGATCG
GCAATGCCTGCTGGGAACTGTATTGTCTTGAGCATGGCAT
CCAGCCAGATGGGCAGATGCCCAGCGACAAAACCATCGGA
GGAGGTGATGACTCCTTCAACACCTTCTTCAGTGAGACCG
GAGCTGGAAAACACGTCCCCAGGGCTGTCTTTGTAGACCT
GGAGCCCACTGTCATTGATGAGGTGCGCACTGGGACATAC
CGTCAGCTGTTCCACCCTGAGCAGCTCATCACAGGAAAGG
AAGATGCTGCTAATAACTATGCTCGTGGTCACTACACTAT
TGGCAAGGAGCTCATTGACCTTGTTTTAGATAGGGTTCGC
AAACTGTCTGACCAGTGCACAGGTCTCCAGGGTTTCCTGG
TCTTCCACAGCTTTGGTGGTGGCACCGGTTCTGGCTTCAC
CTCTCTGCTGATGGAGCGTCTGTCTGTCGACTACGGCAAG
AAGTCCAAGCTTGAGTTCTCCATCTACCCCGCTCCTCAGG
TCTCCACCGCTGTGGTAGAGCCTTACAACTCCATCCTGAC
CACCCACACCACCCTAGAGCACTCTGACTGTGCCTTCATG
GTAGACAATGAGGCCATTTATGATATCTGCCGTAGGAACC
TTGACATTGAGCGTCCTACTTACACCAACCTCAACAGGCT
GATCAGTCAGATTGTGTCCTCCATCACAGCCTCCCTTAGG
TTTGATGGTGCCCTCAATGTGGATCTCACTGAGTTCCAGA
CCAACTTGGTGCCCTATCCTCGTATCCACTTCCCTCTGGC
TACCTATGCCCCAGTGATCTCCGCAGAGAAGGCTTACCAT
GAGCAGCTCTCTGTGTCTGAAATCACCAATGCTTGCTTCG
AGCCGGCCAATCAGATGGTCAAATGCGACCCACGTCACGG
CAAGTACATGGCCTGCTGTCTGCTGTACCGTGGTGACGTG
GTACCCAAAGACGTGAACGCCGCAATCGCCACCATCAAGA
CCAAGCGCACCATCCAGTTTGTGGACTGGTGTCCCACTGG
TTTCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTT
CCAGGTGGTGATCTGGCTAAAGTGCAGAGGGCCGTGTGCA
TGCTGAGCAACACGACAGCTATTGCTGAGGCCTGGGCTCG
TCTGGATCATAAGTTTGATCTGATGTACGCCAAGCGCGCC
TTTGTGCACTGGTACGTGGGTGAGGGTATGGAGGAGGGCG
AGTTCTCTGAGGCCAGAGAGGACATGGCTGCCCTGGAGAA
AGATTATGAGGAGGTTGGAGCTGAGAGTGTGGAAGGAGAA
GATGAGGGTGAGGAATATTAGAAATGCTGCCTGCTGTGTT
TCCTGTCCATTGTCATATTTTTGTGTTCTATTATAACTTT
CCAGTTGTCAACTGGCTAAAAGGTCAATCCTTGCGACACT
TTTAGAAAAAATAAAATTTTGCAACATG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tuba1b-201 Contained in:
OTHER tuba1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026993 (1)
  • Ensembl_Trans:ENSDART00000123518 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF029250 (1) 1485bp
    GenBank:CN838895 (1) 896bp
    GenBank:CO924442 (1) 895bp
    CITATIONS (2)