header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9553
Transcript Name: dnmt3bb.1-201
Previous Name: dnmt3bb.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026962 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026962|OTTDARG00000021259|ZDB-GENE-050314-1 dnmt3bb.1|OTTDARP00000022102 dnmt4-001 LG_none CR318674.9,BX927275.8 Danio rerio protein_coding KNOWN, 3678 bp
CGATTCGAGACCCGGGAAAAGTCACGCCTGACTGTAGTAG
AGGCGAAAGACCGAGCGGTCCTTGAGAACGAGACTCCATT
TACATATTCACCCTTGGGCTTTAAAGGCGTGTGCATCAGC
AAACATTAGCCTGACATACCTCGGCACTTTGGCAGTGGAC
TACTCTTACGGCACCTTCAATCTCTGCTATCAAGCGTTAA
CTAATATCAGTACTTCTCCACAAGACAGGATGAGGAAGGA
AGAAATAAAAAAGTCGACTGAAATAGTGATGCCATCCAAC
AAGTACCCCTCCGCGGAAAGTGACAAGATGACTGCCACGG
CTGCCATGAATCGAGACACATCTGTGGGCGATGGATTGTC
AGAGAATGACAGCGGTCTGGAAATGACCAGTGAAAACAGC
CCCCTGACCCCAGCAGAGCCCCCGTCACCATTCTGTCCCA
AACAGAACGGTGGTGCAGCCTCACCCGCAGATGAGAGTGT
GAACAGCATCAGACGAAAGAGGTCTCGTAAGCGCTCTGAC
ACTGAGGAAGACAGTGCCTGGGATTCCTCCTACAGCGAGG
AAAAGGCTGAGGTTGGGTCGGGTTGTGAGACAGGTCTCCG
GCAAAGGCCTCGCCCCAGGACTATTTTCCAGGCAGGACTA
ACAGCTCACAGTAAACCCCGCAGCAGAGAAAGGGGACACA
GCAAAGAGGATCACAGCGACCTGGTTGCTAGTGTCCCTGA
AGGTCCAGCACTGGAGCTCATGGAGCAGGACTCTAAAGAC
TCTGCACAGAGCAGCACCACATCCACCTCCACTACTGAAA
CAGCCAGTCAACCTGAATACAAGGATAATAAGGGCTTTGG
TATTGGAGAGTTGGTCTGGGGCAAGATAAAGGGCTTCTCG
TGGTGGCCAGGGATGGTGGTGACCTGGAGAGCAACTGGGA
GGAGGCAGGCCTCCCACGGCATGCGTTGGCTACAGTGGTT
TGGTGATGGGAAATTCTCAGAGGTGTCTGCTGACAAACTC
GACTCTATCACAGCCTTCCCAAAATTTTTCAACCAGTCAT
CCTACACCAAGCTGGCCTCCTACCGTCGAGCGATCTTCCA
GGCCCTTGAGGTGGCTAGTTTACGTGCAGAGAAGACTTTT
CCTCCATCTGAGGCAGACAGTCTTGAAGAACAGGTAAAGC
CCATGCTCGACTGGGCTCACGGTGGCTTCCTGCCCAAGGG
TCAGGAGGGTCTTAAACCCAAAGAGAATGCAGAGTATTGT
GTTTTCCCCCTGGCCTCAGAGAGCTCAACGCTGCTGGAAT
CCAGCCCTCCAGAGTTTCCCCCCTCTGCCAAAAGAGCTCG
ACTCCCCCTTAATAAGGCTAAACCTGGCATTGAGGAGGTC
TACAGCAGAGAACAAATGGTCAATGAAGTTTTGAAGAATC
ACAGAAGTATAGAAGAGTTCTGCCTCTCTTGCGGAAAGAC
AAGAGTTGCGACCTTTCACCCGTTGTTTGAAGGAGGCCTT
TGCCTAACATGCAAGGATGCTTATCTAGAGAACTCCTACA
TGTACGATGACGATGGCTACCAATCGTACTGCACCGTGTG
TTGTGGCGGCCGTGAGATGCTGCTGTGTGGAAACGCCAAC
TGCTGCAGGTGTATTTGTGTGGACTGTCTGGATATATTAG
TGGGAGCAGGAGCAGCTAACAGTGCCCGTAATCTGGACCC
GTGGCGCTGCTACATGTGCCAACCTCTGCAGCAATATGGC
GTCTTAAAGAAACGTCATGACTGGAGCCTCAAACTGCAAG
AGTTTTTTGTCAATGACAGCGGCCAGGAATTTGAAAGTCC
AAAGATTTACCCTGCAGTCCCAGCAGAGCAGAGACGGCCA
ATCAGAGTGCTTTCGTTGTTTGATGGCATTGCCACAGGTT
ATCTGGTGCTTCGGGACTTGGGCTTCAAGGTTGATTTGTA
CATTGCGTCAGAAGTATGCGAGGACTCGATTTCAGTGGGA
GCTGTCCGGCATGAAGGAAAAATCCAGTATGTGCATGATG
TTCGCAACATCACCAGAAAAAACATTGCTGAATGGGGGCC
CTTTGACATGGTGATTGGTGGAAGTCCCTGTAATGACCTT
TCAATTGTCAACCCTGCTAGGAAAGGTCTGTACGAGGGGA
CTGGACGGCTGTTCTTTGAGTTTTATCGCCTCTTGAGTGA
AGCGAAACCAAAGGAAGGGGAAGACCGGCCTTTCTTCTGG
ATGTTTGAGAATGTGGTGGCCATGAGCGTCAATGACAAGA
GAGATATCTCACGCTTTCTAGAGTGTAATCCAGTGATGAT
TGACGCCATAGAGGTGTCGGCTGCTCACAGGGCACGCTAT
TTCTGGGGCAACCTGCCAGGAATGAAGAGGCCTCTGTGTG
CCTCTGGGATGGATAAATTAGAGCTTCAGGACTGTTTGGA
ACATGGCCGTGTTGCCAAGTTCGGGAAGGTACGTACCATC
ACAACACGCTCCAATTCCATCAAACAAGGCAAAGACCAGC
ATTTCCCTGTCATGATGAATGGCAAAGAGGATATCCTGTG
GTGCACAGAGCTCGAGAGGATTTTTGGCTTTCCTGTTCAC
TACACAGATGTCTCCAACATGGGCCGTGGCGCCAGACAGA
AGCTGCTGGGGCGATCCTGGAGCGTTCCAGTTATCCGACA
TCTGTTCGCCCCACTGAAGGACTACTTTGCGTGTGAATAG
CACATGTAGTCCGCGTTCAGTTAATCTAAAGCAAACACAA
AGTACAAGACCAAATGTCCTCAAAAAGGAGCTCTTAGAGA
CCCACAAATTTGACAAGACCATCTCAGCTTTGGAAAAACA
AGCATGAGAAGCTGTGACTTGAGGTCGAGGGTAGTGTTGA
GCAACAGGCCAAACTCAAGGTAGACACTGTGATGCTAAGA
GCGAAAACACAGTTAGCTTTTGTACTCGACGTTTTTAAAA
TGGATGTGCCTGAAAACGGCCAGGGTTCACATGCGGGTAG
ATTAATCTTTTATTATCATGAGAAAAAAAAAATAATAATT
TTTAATCGAACAAAACATTTTAGTTTCTTCCAGAGCAAAT
CTGGCTAAGCAATGCTGAAATGTGTGAACTTTAAATTCCT
CATTCATGCATGTGACTCATGTTCACCATATTATCGGGGT
GAAAGAAATACTTGAAAAATTGTATCAATGCAAACTTCCA
AACACCAAGCTGTGAACCCTTAAAGAATGCGTTTTAGAGG
ATGCGTTCAAATAGTCGATCGCCCCTATTTGTGTTTCATA
AAGCCTCCATGCCCTCTGTATCGTTGCACAATAACAGTAA
CCAGAAGGTGTTTTCTTTTATATCATTAGCAGAACTCGAG
GGCATTAGCCTGTTAAACATTACAGTTCTTTCCTTAAGTA
ATTTGTGTCGTTCAAGCAATCGTTCAAGATAGAGATCAGT
GTACTGTATTTTAACTTTGAAAGTAATGTTTACAAACTTT
AACACATTTCAACAAGTTTTTAGAGCTTTCTTACCATACT
TTCTTTGTTTTTTAGCCTGCTTTAGATGTAAAATGTTTGA
TGCTGTTGTTTTTAATATTCACTGTTGCTGCCAACAATAA
CAAACGCATTGTATTATTGTAGCACTCTGATGCCTTAATG
TGTGGTGCCTTTTGAAGAGAACAGATACAGCCTGCCATAC
GGGCGTTGCGAAGAAACTTTCTGCCTTTGTTTGCTGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnmt3bb.1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026962 (1),  Ensembl_Trans:ENSDART00000053418 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AB196915 (1) 3544 bp
GenBank:BC124098 (1) 2921 bp
GenBank:DT069753 (1) 837 bp
GenBank:BG307263 (1) 528 bp
GenBank:BI474006 (1) 299 bp
CITATIONS (2)