header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9510
Transcript Name: myod1-201
Previous Name: myod1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026919 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026919|OTTDARG00000021238|ZDB-GENE-980526-561 myod1|OTTDARP00000022067 myod-001 LG_ BX004812.8 Danio rerio protein_coding KNOWN, 1772 bp
CTCTTACCAGCAACAAGTACCTGAGGGGTACATGCAAAGA
AACCCTCCGAGGTCCTGCGAATTTTAGACTGTAGTTTTGA
AACGTACGTTATTTCGGGATCTGAAGGACTTTGTCTTACT
ATTCCTAATTTTGGTTTTTATTTTTTTTACAAATTTACTA
CTTTGGAAACATTCAAGTACATTTCTTGCTTTTTAAACTT
TAACACAAAAAAGATGGAGTTGTCGGATATCCCCTTCCCC
ATCCCATCAGCTGATGACTTCTACGACGACCCTTGCTTCA
ACACCAACGACATGCACTTCTTTGAAGACTTGGACCCCAG
GCTTGTTCACGTGAGCCTGCTCAAACCCGACGAGCATCAC
CACATCGAGGACGAGCACGTGAGGGCGCCCAGTGGGCATC
ATCAGGCCGGCAGGTGCCTACTGTGGGCATGCAAAGCTTG
CAAGAGAAAAACTACCAATGCTGACCGTCGCAAAGCCGCC
ACCATGAGGGAGAGGAGGCGACTGAGCAAGGTCAACGACG
CTTTCGAGACCCTCAAGAGATGCACGTCCACCAACCCGAA
CCAGAGGCTGCCCAAAGTGGAGATTCTGAGAAACGCCATT
AGTTATATCGAGTCTCTGCAGGCTCTTCTCAGAAGTCAAG
AGGATAACTACTATCCCGTTCTGGAACATTACAGTGGAGA
CTCTGATGCTTCCAGTCCGAGATCCAACTGCTCTGATGGC
ATGATGGATTTTATGGGCCCAACGTGTCAGACGAGAAGAC
GGAACAGCTATGACAGCTCTTACTTCAATGACACACCAAA
TGCTGACGCACGGAATAATAAAAACTCAGTGGTGTCGAGT
TTGGATTGTCTGTCCAGCATCGTGGAGCGAATTTCCACAG
AGACTCCTGCATGTCCCGTGCTGTCAGTACCGGAGGGGCA
CGAAGAGAGCCCGTGTTCTCCGCATGAGGGATCTGTCCTG
AGTGACACCGGAACCACCGCACCGTCCCCGACCAGCTGCC
CTCAACAGCAGGCTCAGGAAACCATTTATCAAGTGCTTTA
AAATTCTGCAACATTTCAAAACAAATTGAAAAAGACAATC
TGAATGAAGAAACTTTCAGCAGAAAAAGGCGAATCCGACC
TTTAACGACAAAAGAAAGACTTTTGATCCACTGCTGGAAA
CTAGGAAAGAATGCTTTCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTTCTTTCTTTCATAGACTAATTCTTTTTTTCTT
TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTT
TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTTCTTTCTTTCTTTATGCGGTGGAAAATGTAAT
TCCAATATGAGAAAAGACTCAGCAGATCAGCAGAAGTGAG
TTTCTTAACTAAGCTTATTTATATTGTTATATCCACGTGA
AAATGTGACCATATTTTTTTCCCTTTGTGAATATATTTTC
TGTCACCATCACCTTTTATTTTCCTAATTATTTACGGAAA
AAATCGTAATCCAGATACGAATAGTAGGACCATTTTTGTA
TATGTGTAAATAAGATCTGTTTTGTTAAAGCGACGAAAAC
GAACAAACATATTATTGTATTTAATGATGCCTGTTTGAAA
CACTAGTTTGTTGTGTCTTGTGTTAAACTTTATATTTATA
CTTCTTAAACGAGTGAATGACGGATAAATAAAAACAACTA
TTTATACTGGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myod1-201 Contained in:
OTHER myod1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026919 (1)
  • Ensembl_Trans:ENSDART00000027661 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC114261 (1) 1762bp
    GenBank:CT664740 (1) 784bp
    CITATIONS (2)