ZFIN ID: ZDB-TSCRIPT-090929-9505
Transcript Name: hsd17b12a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026913 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026913|OTTDARG00000021234|ZDB-GENE-030131-5628 hsd17b12a|no_translation hsd17b12a-002 LG_ CR376745.11 Danio rerio protein_coding KNOWN, 755 bp
AAGCAGTGCTTAACGACTAATTTTGCAGGTCATTCACCAC
GCGCAGCCAGCCGTAGACATGGAGTCGTTTAACGTGGTGG
AGACGCTACAGCCTGCCGAAAGAGCGCTCTTCTGGGTCGG
TGCACTTATCACGGCCTCGCTGGCGTTGTATGTGGTGTAC
AAGACCATCACTGGATTCAGGATATGGGTGCTGGGAAACG
GGGACTTACTCTCTCCCAAATTGGGAAAATGGGCAGTTGT
GACGGGAGCCACGGATGGGATTGGGAAATCCTATGCGGAG
GAGGTAAGGGTTTCTCTTCTTATTTATCTGTTCGCTCCAC
GGAAAGCACAGTGACTCATCACAAGACAGAGGTTTCACTC
TGAGGCCAAGAGAAGGAGGGTGACTGGAAGACTGCTGGTG
GGAAAAGACCTGTTACCTCGTTTAACTTGTACAGCTAAAA
GTTGTTCTCGCACTCCAAAGTTGGCCATTTCATAACCGTT
TAAAGAGTATGGCGGTTTCTTACAGGTTTCCCCTCAAACA
TTAAGGGTGCTTTCACACCTGTGAATAGATTCAGTTGTTT
CGAAACAGAGATTACAATTGTTACATTGTTGCTCTTTGCT
CTTGGAGCGGTTCGCTTTCACACTGCAAAGTTTTTAATCA
AACCAAAATAGCTAAAACAAGTCACGTGCGATTAAACTCT
CCTTACATTGGTCAGAGTGTCAGGGTTTATTTTGTAGCGT
CCCGCTAAGCTGTCAGGAGAGGTGGTGGTTTGGTG

hsd17b12a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hsd17b12a-002 755
hsd17b12a-003 (1) 885
mRNA hsd17b12a-201 (1) 2012
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hsd17b12a-002 Contained in:
OTHER hsd17b12a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026913 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO814851 (1) 884bp
    CITATIONS (1)