ZFIN ID: ZDB-TSCRIPT-090929-9502
Transcript Name: fbxl22-201
Previous Name: fbxl22-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026910 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026910|OTTDARG00000021232|ZDB-GENE-050227-1 fbxl22|OTTDARP00000022062 fbxl22-001 LG_ CR391977.5 Danio rerio protein_coding KNOWN, 1208 bp
GAGTCCATGTGCCTCACACATTTCCATTTTTGACCGTGCT
TGTAGCAGTACTCCCAAAATAGCCCTCATTCCTTGCAACC
TTATATGTTCAAGGCCTAAGCAAAGACTACAGGGGAGAGA
ATTGCAAATCCAGGTCACACAAGACACAGTGTTGTCTCTG
TTGCTTTGTGGTTATTAGCAGGCCTGTAAGTGTGCTTGCT
ATGCATCTCATAGAACTAGATCAAGAGTGCTTGCTACACC
TTTTTTCATACCTAGACAAGGATAGTCGGCGCAGCCTATC
CTTAACGTGTGTACGACTAAGACAGGTCTTCCTAGACCCT
CAACTGTGGACACTACTTCACTTTTGGTCTCCATGCGAGC
TGAGGAGAGACAACTTTGTTGTGGGATCTTCGCTAAGATA
CCTCGCTGTATGCTGGCACTCAAGCAGGGTCAAAGTGTGC
AACATTGAGCACTGGATGAAAACTACATTCCAAAAGGATC
TCTGTAGCAAGCATGAGAGCTTTGTCAGTGACTTCCTGGA
GCATGTTTGCAACATGTGTCCAAATCTGATCTCACTGACT
CTGTCTGGATGTGGGCACATAATGGACAACAATGTCATCA
AAGTGCTACAAAGCTGCAGAAGGCTACGTAGCCTGAGTCT
AGAAAACTGTGCTCGGATAACAGACTCTGTACTCAAGGCT
GCGGTGGAGCATGGCCACAATCTCACAGAGGTGAGAGTGG
ACTTTTGCCGCAATGTGACCCAGGCAGGGTTGCAGGAGCT
AAAAAACAAGAGACCAGAAGTACTTCTGAGTGCATTACAC
AGTGCGGATATGATTCCAGATTGCAAGCCTGAGGAGAAAA
CACATATCAAGAGAGCTCTGCAGAAGTTCTTGATCTTCTC
TTGACTGACCGTTGTGACCTTATGTCAAGATGATATTTAT
TTTCTAATTCTATTATAAATGTTTTTTTTCACCAATTTTT
TGATTCCTTATTTTATGACATGCTAATTTTATTGCTAACA
TTTTATATTTTATTAGTTCCCTCTTTTCACCCACCCTCTT
TTGTACCTTCACTTTCATAGATTGTTTATTCGTTTGTTTG
TCCATTTGACTGCATAAAATGACTCACTAGTAAAGTGCAA
ACTAAGTATTTGATTGTGCTAACAGGGCATTTACCCAATC
CACATGTTTTAGTGAAATCTAGTGTTTCAATAATAAAACT
TTAGCAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fbxl22-201 Contained in:
[BAC] DKEYP-73B11 (1)

Genome Resources: Vega_Trans:OTTDART00000026910 (1),  Ensembl_Trans:ENSDART00000067114 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC090262 (1) 1100 nt
GenBank:CT641961 (1) 707 nt
CITATIONS (2)