Transcript

sept6-201

ID
ZDB-TSCRIPT-090929-9448
Name
sept6-201
Previous Names
  • sept6-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026845 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026845|OTTDARG00000021193|ZDB-GENE-030131-1414 sept6|OTTDARP00000049131 sept6-004 LG_ BX571981.5 Danio rerio protein_coding KNOWN, 1219 bp
AACAAGATGGTGCGAGCACGCCAGTACCCATGGGGAACCG
TCCAGGTGGAGAATGAGAATCACTGTGATTTCGTGAAGCT
GAGAGAGATGCTGATCAGGGTCAACATGGAGGACCTGCGG
GAGCAGACCCACACTCGCCATTATGAGCTTTATCGCCGTT
GCAAACTGGAAGAGATGGGATTCAAAGACACTGACCCCGA
TAGCAAACCTTTCAGCCTTCAGGAAACATATGAGGCCAAG
AGGAATGAGTTCATGGGTGAGCTTCAGAAGAAAGAGGAGG
AGATGAGGCAGATGTTTGTCCAGAGAGTCAAAGAGAAGGA
GGCAGAGCTGAAAGAGGCAGAAAAGGAGCTGCATGAGAAG
TTTGATCGCCTCAAGAAACTTCACCAGGACGAGAAGAAGA
AACTGGAGGACAAGAAGAAGTCTCTTGATGATGAGCTGAA
CGGCTTCAAGCAGAAGAAAACTGCTGCCGAGCTGCTGCAG
TCACAGAACCAGCAGCCAGGGGGCTCCGCCACACTCAAGA
AGGACAAAGAGAGGAAAAACTTCTTTTAACTCTGTCTTGG
CCACCTGTTGGAAGAGGGGATCGCAGCTTCCACAAGAACT
AAGCATCCGCTCTTCTTCCTGTCTTTGTCACTCCGTCAGC
CTTGTTTGAATGTTTTATTTAATTTTTTTATTTCATGCTG
TGTGCCCTGTTAAACATGGCCTTATGTGGGCTTAACATGG
TATTTTTCAACAAATATTAGCTCTGTTTTTTAATTGGGGT
TTGCTAAGCAGTCCCTCTTTAGTATTTTTACAGGCATCAT
TTGCTGGTGACAACAGAGCCAAAGCTCTGGTAGAAAGGCT
GTGAAGTAAAGAAGTGTTTAAGTTTAGCTTTTTGCATCTG
TGATATTGCCTTGCAGTCTCAATCAACCAATCATTTAGTT
GCTTTTACGAGTTCATGTGTTTGTGAATGAACCTGCATGT
GAAGATTAACACAGTTTTAACTGTGAAGAATGAATGCATA
CTAACTTATTTGCAAACTCTACATTTTAGGATGTGAACTA
AGTTCAGCAAGATTATCTTTAATAAGACTTTTTGACACAC
TGGCTGTGAATATTGAGCAAATCCAAAGACAATGGGCCTG
AACGTTATTGCTTGCTAATGCAGCAAAATCTTAAGTCAGA
GATATTTAAGGAGTTTATTTGTTTTATCTGAGAGCATGAG
TTAAATAGAAGCAAAATCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations