Transcript

sept6-203

ID
ZDB-TSCRIPT-090929-9445
Name
sept6-203
Previous Names
  • sept6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026842 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026842|OTTDARG00000021193|ZDB-GENE-030131-1414 sept6|OTTDARP00000022004 sept6-001 LG_ BX571981.5 Danio rerio protein_coding KNOWN, 2779 bp
GGTACAGTCCATCGTATGTGAGTAGTCGCTGTAGCTTCAG
TTTGCGTGCTGCTGCAGTTTCCTGTGAAGGTTTGATGCAG
GAGAGAACCATGGCGGCCACTGAGATAGCACGACAAGCGG
GAGAGGGTGCACGTGCTGTCCCACTCTCTGGTCATGTTGG
CTTTGACAGCATGCCGGACCAGCTGGTCAACAAGTCCGTC
AACCATGGTTTCTGCTTCAATATCCTCTGTGTGGGGGAGA
CGGGTTTGGGAAAGTCAACCCTCATGGACACCCTGTTTAA
CACCAAATTTGAGGGCGAACCTACACAGCACAATCAGCCT
GGAGTGCAGCTCAAATCCAACACTTATGAGCTGCAGGAGA
GTAATGTCCGACTCAAGCTCACTGTGGTCAACACTGTAGG
ATTTGGAGACCAGATCAACAAAGAGGACAGTTACAAGTCT
ATTGTGGAGTTCATCGATGCTCAGTTTGAAGCGTACCTTC
AGGAGGAACTGAAGATTAAACGCACACTACACAGTTATCA
TGATACACGGATCCACGCTTGCCTGTATTTCATTGCTCCC
ACTGGACATTCGCTTAAGTCCCTTGACCTGGTGACTATGA
AGAAGTTGGACAGTAAGGTAAATATCATCCCCATCATTGC
CAAATCAGATGCCATTTCAAAGAGTGAACTTGCCAAGTTC
AAAATCAAGATCACGAGTGAGTTGGTGAGCAATGGCGTCC
AGATCTACCAGTTTCCCACTGATGATGAGACCGTGGCGGA
GATCAACTCAACTATGAATGGTCATTTGCCTTTTGCAGTG
GTGGGAAGCACTGAGGAAGTGAAGATTGGGAACAAGATGG
TGCGAGCACGCCAGTACCCATGGGGAACCGTCCAGGTGGA
GAATGAGAATCACTGTGATTTCGTGAAGCTGAGAGAGATG
CTGATCAGGGTCAACATGGAGGACCTGCGGGAGCAGACCC
ACACTCGCCATTATGAGCTTTATCGCCGTTGCAAACTGGA
AGAGATGGGATTCAAAGACACTGACCCCGATAGCAAACCT
TTCAGCCTTCAGGAAACATATGAGGCCAAGAGGAATGAGT
TCATGGGTGAGCTTCAGAAGAAAGAGGAGGAGATGAGGCA
GATGTTTGTCCAGAGAGTCAAAGAGAAGGAGGCAGAGCTG
AAAGAGGCAGAAAAGGAGCTGCATGAGAAGTTTGATCGCC
TCAAGAAACTTCACCAGGACGAGAAGAAGAAACTGGAGGA
CAAGAAGAAGTCTCTTGATGATGAGCTGAACGGCTTCAAG
CAGAAGAAAACTGCTGCCGAGCTGCTGCAGTCACAGAACC
AGCAGCCAGGGGGCTCCGCCACACTCAAGAAGGACAAAGA
GAGGAAAAATTAACTCCTCACCTGCTCCCAGTCCTGCATG
AGACACCTTATGCTGCTTCTTTTAACTCTGTCTTGGCCAC
CTGTTGGAAGAGGGGATCGCAGCTTCCACAAGAACTAAGC
ATCCGCTCTTCTTCCTGTCTTTGTCACTCCGTCAGCCTTG
TTTGAATGTTTTATTTAATTTTTTTATTTCATGCTGTGTG
CCCTGTTAAACATGGCCTTATGTGGGCTTAACATGGTATT
TTTCAACAAATATTAGCTCTGTTTTTTAATTGGGGTTTGC
TAAGCAGTCCCTCTTTAGTATTTTTACAGGCATCATTTGC
TGGTGACAACAGAGCCAAAGCTCTGGTAGAAAGGCTGTGA
AGTAAAGAAGTGTTTAAGTTTAGCTTTTTGCATCTGTGAT
ATTGCCTTGCAGTCTCAATCAACCAATCATTTAGTTGCTT
TTACGAGTTCATGTGTTTGTGAATGAACCTGCATGTGAAG
ATTAACACAGTTTTAACTGTGAAGAATGAATGCATACTAA
CTTATTTGCAAACTCTACATTTTAGGATGTGAACTAAGTT
CAGCAAGATTATCTTTAATAAGACTTTTTGACACACTGGC
TGTGAATATTGAGCAAATCCAAAGACAATGGGCCTGAACG
TTATTGCTTGCTAATGCAGCAAAATCTTAAGTCAGAGATA
TTTAAGGAGTTTATTTGTTTTATCTGAGAGCATGAGTTAA
ATAGAAGCAAAATCTGAGAGGTTTGTATTGTATGTTTTGT
AATGCCCTATACATTTTACAGCACACATTTCAAGTCTTAA
ATAGTCACAGCAATATAGTTACACTTATTTTAATTATATT
ATCTTCGAGAGTAATAGAGCATCTATTGAAATACCATGTA
GGTCACATTCAGTGCCATTTTTATATTCTTTATCTTCTGT
TCTTCTGCATGGCCTGAACATTTATATTTAATTTCTTATT
TCGTTTTGTTTATATAGAGAGTTAATCTTTACTTTGACAT
ATTTACTCTTCTTTGGATCATTTATTCTAGGTACAGTGTG
CATTCAGTTTCTAAATGGAATTTCCCATTTTGCCAAATAT
TGCATTTAGATATACGTCAAGGTTTTTTTTTTTTTTTGTC
ATTTAATGCAAGTCAGTTACGAGGTACAGATGTTCATGCA
TATGTGCAGTACATATACTTTTTTTCAGGACCTATTTTGC
GTATCAGTGTTGAGACATGTTTCAATGATTATTGACAAGT
GACTGTTTTCTGTGTAAAACATTTTGAGTGTCAAAACTGG
TCTACATTTTTCTAGTCACCTTCTACATTTCCCCATTTAT
GTCAATTACCCTCATCCTTGTAATACCAGAAATTTGTGAA
ATATTTATCTGTAGTAAGATTCCATGGTGTACATTTTCAA
TAAAATGACAATAAATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations