Transcript

ireb2-201

ID
ZDB-TSCRIPT-090929-9388
Name
ireb2-201
Previous Names
  • ireb2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026769 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026769|OTTDARG00000021150|ZDB-GENE-051205-1 ireb2|OTTDARP00000021944 ireb2-001 LG_ BX296538.9 Danio rerio protein_coding KNOWN, 3091 bp
GAGCGAGTGGAGTCGTGTTAACAGTAGGACTCATCATGGC
GCTCGGTTCGCTTCAGAACGAGCATCCATACGGCCATTTG
ATTGACACTCTCCAGAGCGAACAATATCAAGAGCAGAAAT
ATTTCAGCCCACAGAAGCTTAATGATGTCAGATACGAGAA
ACTGCCGTTCTGCATGCGGGTTCTCCTGGAGTCCGCCATT
CGGAAGTGTGACGAATTCTACGTGAAAACAGAGGATGTAT
CCAGTATTTTGGACTGGCAGGTGCAGCAGAATCAAGCAGA
GGTTGTGTTCTCGCCCGCCCGGGTTCTGCTGCAGGATTTC
ACGGGAATTCCCGCTATGGTGGATCTGGCAGCCATGAGAG
ATGCTTTAGCTAAACAAGGGGTCGATCCGAGCCTGGTGAA
CCCAAGATGCCCCACAGACCTCATCGTAGATCATTCACTG
CAGATCGACTACAGCAAATGCGGCATCCAAAGCCCTCCAG
CATCTGTGGATGAGAGTCCGACTGTCAAATCTCCAGCCGG
TCGACCATCTCCCAGAGTAAGCAGCTCTAGCGGTCACTGT
TCGGGTCAGCGGTCGGGTCATCGGGGTGGCTGCAGTAAAC
CCTCCTGCTCCGACGCCCCTGGTGGCAGAACAGCAGCAGT
ACAGATAGAAAACACACCTCTGCTCTGCCCTTTCCACCTA
CAGCCCGTTTCAGAGCCTGAAACAATGGTCAGAAACCAAG
AGATGGAGCTAATCAGAAACAAAGAGAGGCTGCAGTTCTT
CAAGTGGTGTTCAAAATCCTTTAATAATGTCAACGTGGTC
CCGCCAGACATCAGCACTGTACATCAGCTGAATCTGGAGT
ACTTGTGTAAGGTGGTGCAAGAAGAGGAGGGCTTTATTTA
TCCAGACAGTGTGGTGGGAACAGACTCTCACACAACTATG
ATTAATGGCCTCGGGATCCTGGGCTGGGGAGTTGGAGGTA
TTGAATCTGAGGCGGTGATGTTAGGTCAGCCGGTATCTTT
GACTTTGCCGCAGGTGGTCGGCTGTAAACTTGTGGGGACC
ATTAATCCTCTTGCCACATCCATTGATATTGTCCTGGGTA
TTACTAAGCATCTGCGTCAGGCAGGAATCGGTGGGAAGTT
TGTGGAGTTTTTTGGGCCTGGTGTCCCGCAGCTCTCGGCT
CCCGATCGGACCACCATCGCCAACATGTGCCCTGAGTACA
ACGCCACCGTCAGCTTCTTCCCTGTGGATGACATCACCCT
GCAGCACTTTAAACACACCATCTGCAGTGAGGAGAAGCTG
CTGGTTTTAGAAGATTATCTAAAGGCTGTCAAACTCTTCA
GAAGCTACGACGACCAATCAGAAGAGCCGCAGTATTCAGA
GGTTATTGAGATGAACCTGAGCTCCATTGTGCCGCATGTC
AGTGGACCCAAACGGCCGCAGGACAGGGTCGCCATCACCG
GCATGAAGGAGGACTTTATCAGCTGCTTAAATGAGAAGGT
TGGTTTTAAAGGCTTCCACATATCCAAAGAGAAGCAGTCG
ACTCTGGTGCCGTTCCGGCATGATGGTGCGGAGTATAACC
TTGCGCACGGATCTGTGGTCATCGCCGCTGTCATCAGCTG
CACCAATAACTGCAACCCGTCCGTCATGCTCGCTGCAGGT
CTGCTAGCGAAGAAAGCTGTGGAGGCTGGGCTGACGGTAA
AACCATACATCAGGACGAGCCTGGTGCCCGGCAGCGGAAC
AGTCACACATTACCTGAACACCAGCGGAGTCCTGCCCTTC
CTCAAGAAACTCGGTTTTGAGGTTGTAGGTTATGGATGTG
CGACGTGTGTAGGAAACACAGCACCTTTACCTGAAAGTGT
GGTGGACGCCGTCAAACAGGGTGATTTGGTGGCGTGTGGC
GTTCTGTCCGGAAACAGGCATTTAGAGGGACGCCTCTGCG
ACTGCGTGCGGGCCAATTATTTGGCCTCCCCTCCGCTAGT
AGTCGCATACGCCATCGCAGGCACTGTCAGTATAAACCTG
GAGACGGAGCCACTGGGAGTGAACGCAGACGGCAAAGACG
TGTTTCTGTGTGATATCTGGCCGACCAAAGAGGAAGTGAA
CCACATAGAGGAGAACATCGTCATCGCCTCCATGTTCACC
GAGCTGAGGAGCCGGATGGAGAAAGGAAGTTCGTTCTGGA
ATAATTTAGAGTCTGCTGAATCTGCACTCTTTCCGTGGGA
TCCCAAATCCACCTACATACGCTGTCCGTCCTTCTTCAGC
AAAATGTCTAAAGAGGTGTGCTCTCCTCAGTCCATTGACG
GCGCATATCCGCTCCTCTTTCTGGGTGATAAAGTAACAAC
CGATCACATTTCTCCAGCTGGAAGCATCGCACGAGTCAGT
GCTGCCGCCAAATACCTGCAGAGCAAACGTCTGACCCCTC
GTGAGTTCAATTCTTACGGCGCACGCAGAGGAAATGATGC
CGTGATGACTCGAGGAACGTTTGCCAGCATAAAGCTTCAA
AACCGCCTCATCGGGAAAACCGGACCCAAAACACTGCACA
TTCCTACAGGACAGACGCTGGATGTGTTTGAAGCTGCTGA
GCGCTATCAAAGAGACGGAGTTCCTCTCATCATCCTGGCT
GGAAAGGAGTACGGCTCAGGCAGCTCACGGGACTGGGCTG
CCAAAGGACCTTATTTACTGGGCGTGCGTGCGGTGATAGC
TGAGAGCTTTGAAAAGATTCATAGGAATCATTTGGTGGGG
ATGGGAATCGCTCCTCTTCAGTTTTTGCCAGGACAGAATG
CAGACTCACTGGAGCTGTGTGGAAAAGAGCGATTCACCAT
CGACATCCCAGAGGAGCTCACGGCCAGACAGCAGATCACT
GTACAGACGAGCACTGGGAAGAGTTTCATGGTCACGGCTC
TCTTCGAGAACGACATGGATGTGGAGTTTTTCCGACACGG
AGGCATCCTGAAGTATGTGGCTCGCTCTCTGCTGCCGTAA
AGCATAATCACATGGACCTCTGAACACCACAGCGCCACCT
AGAGGCTTTCAAGAGGCCTTAAAAACTGAACGCTGTGCCT
CTCGTTTGCCCAATCCTCCAGAGGATGTCATTATTTTGCA
CTTAAAGACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations