Transcript

dcaf13-002

ID
ZDB-TSCRIPT-090929-9375
Name
dcaf13-002
Previous Names
  • wdsof1-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026756 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026756|OTTDARG00000021141|ZDB-GENE-040426-703 dcaf13|no_translation wdsof1-002 LG_ CR925804.8 Danio rerio protein_coding KNOWN, 694 bp
CTCAAAGGCAACATATATCTAAACAAGATTTTTATGTATG
ATTTTGCTGTTTATAACCCGCTGGAATGAAAGTTAAAGTG
CTTTGCAGAAACCCGGACGATTATGTTCGAGAGACAACCA
GAGATATACAGCGAGGTATGTAAACAAGCATCGACCGTAT
GAAGGTGGTCTACAGGTAAGATGTACATTAACTGCAGTAA
CTTATGTTCCTTATGTAGTACCCAGGAACTATGACCCGAC
CCTGCACCCTTTTGAGGTGCCCAGAGAATATACCAGAGCC
CTGAATGCCACCAAACTGGAGAGGGTGTTTGCCAAACCTT
TTGTGGCCTCGCTCGACGGGCACAGAGATGGCATCAGCTG
CATTAGCAAACACGCCAAAAGCCTGTCCACAGTCATATCT
GGCGCCTGCGATGGCGAGGTGAAAGTTTGGAATCTTCCCA
AGCGAGAGTGTACGAGGACGGTTCAGGCTCACGAAGGATT
TGTGCGAGGAATCTGCTCCCGCTTCTGTGGCACCTCGTTT
TTCACGGTAGGAGATGATAAAACTATCAAACAGTGGAACA
TGGAGGCTCCAGGATATGGAGTTCGGGAGGAACCAATTAA
CACCATTCTGGGGAAGGCGGTGTTCACTGGCATTGACCAC
CACCAAAGGGAGGGCACGTTCGTTACCTGCGGGCAGACGG
TGGATATCTGGGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations