Transcript

dcaf13-201

ID
ZDB-TSCRIPT-090929-9374
Name
dcaf13-201
Previous Names
  • dcaf13-001
  • wdsof1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026755 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026755|OTTDARG00000021141|ZDB-GENE-040426-703 dcaf13|OTTDARP00000021934 wdsof1-001 LG_ CR925804.8 Danio rerio protein_coding KNOWN, 1740 bp
ATTCTGCGATTACAGAACCCGGATGTGTTTCTGCTAAAGT
GACGTCAAATTAGTGCGCGGTCCGTCATACAAACACATGG
TCTTGCGTTTTCTCAAAGGCAACATATATCTAAACAAGAT
TTTTATGTATGATTTTGCTGTTTATAACCCGCTGGAATGA
AAGTTAAAGTGCTTTGCAGAAACCCGGACGATTATGTTCG
AGAGACAACCAGAGATATACAGCGAGTACCCAGGAACTAT
GACCCGACCCTGCACCCTTTTGAGGTGCCCAGAGAATATA
CCAGAGCCCTGAATGCCACCAAACTGGAGAGGGTGTTTGC
CAAACCTTTTGTGGCCTCGCTCGACGGGCACAGAGATGGC
ATCAGCTGCATTAGCAAACACGCCAAAAGCCTGTCCACAG
TCATATCTGGCGCCTGCGATGGCGAGGTGAAAGTTTGGAA
TCTTCCCAAGCGAGAGTGTACGAGGACGGTTCAGGCTCAC
GAAGGATTTGTGCGAGGAATCTGCTCCCGCTTCTGTGGCA
CCTCGTTTTTCACGGTAGGAGATGATAAAACTATCAAACA
GTGGAACATGGAGGCTCCAGGATATGGAGTTCGGGAGGAA
CCAATTAACACCATTCTGGGGAAGGCGGTGTTCACTGGCA
TTGACCACCACCAAAGGGAGGGCACGTTCGTTACCTGCGG
GCAGACGGTGGATATCTGGGATGAACAGAGAAGCAGCCCC
GTCTTGTCCTTCAGCTGGGGTGTGGACAGTTTCAGCAGCG
TTCGCTACAACCCTGTGGAGACTGACCTTCTCGCCAGCTG
TGCATCAGACAGAAGTATTGTGTTGTATGACACCAGAGAA
TCTGCACCACTCAGAAAGGTTATCATGCAGCTGAGAAGCA
ATACGCTTTGCTGGAACCCAATGGAAGCATATTATTTTAC
CTGCGCAAACGAAGACTACAACCTTTATACATATGACATA
AGGAATCTGGATGTTCCTGTGACTGTCCACATGGATCATG
TATCCGCTGTGCTGGATGTGGATTATTCACCTACAGGGAG
AGAGTTTGTATCCGCCAGCTTTGACAAAACCGTCCGCATC
TTTCCTAAAGACAAAGGCCACAGCAGGGAGGTGTACCACA
CCAAACGTATGCAGCACGTCATCTGTGTGAAATGGTCGGC
TGACAGCAAATTCATCATGAGCGGCTCAGACGAGATGAAC
ATTCGCCTGTGGAAGGCCAACGCCTCGGAGAAGCTCGGAG
TGCTTTCTACCCGAGAAAAGACTGCCGCAAACTACAACAA
AAAGCTGATACAGAAATTCCAGCACCATCCACAGGTGAGA
CGCATTGCCCGCCATCGCCACCTGCCCAGAGACGTCCTGA
AGCAGAAGAGAGAGCTGAAGGAAATGAAGGAAGCACGCCG
CAGGAAGGAACAAAACGTCCGCAAACACAGCAAGCCAGGA
TCTGTTCCCCTGCTGACAGAAAAGGAGAAACATGTGGTGA
AGGTTGTGGAGTAAGAGACCAATTAAAGAGGTGCTTTCGG
TGGATGGGTTTTTGTTCTCCACACTCGGACATGCTCCAGA
ATATTCCACCCTTTGGCCTCTTCTTTACTTCTATACTAAG
ATTATGACCGTCATATATACACACAGACTTTCGGTATATT
GCAGGTTTCTGTTAAACACCCATTTCTAATTAATTTTACA
TGGACTCTGTACTAGAGTTGCTGTTGTTAGACTATGAACA
ATAAAAAAAAGTTTACTCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations