Transcript

slc5a5-201

ID
ZDB-TSCRIPT-090929-937
Name
slc5a5-201
Previous Names
  • slc5a5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007273 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007273|OTTDARG00000006581|ZDB-GENE-060503-585 slc5a5|OTTDARP00000006470 slc5a5-001 LG_ BX119975.7 Danio rerio protein_coding KNOWN, 1698 bp
ATGGCTATGGACTCTGACAGACCACCGGGCTTCTGTTTGG
TGGATTATGCGGTATTTGCTGCAATGCTGGGGGTGTCGGT
GGGCATCGGGCTGTTCCAGTCTTTGAGAAAGACCCCGGGT
CGCTCTAAAGTGGACAGCTTCTTCACAGGCGGCAGGGGTT
TCTCTGCTGTGCCGGTTGGACTGTCGCTCTGTGCCAGCTT
TATGTCAGCTGTACAGGTGCTCGGTGTGCCATCAGAGACG
TATTTGTATGGCTTCAAGTTCCTGTATATGTGCCTGGGAC
AAGGGCTCAACTCCCTCATGACGGCCGTTCTGTTTGTTCC
TGTGTTTTATCGCCTTAAAATCACCAGCTCAAGCCAGTAT
TTAGGAATGAGGTTTGGCAGAGGGATGCAGCTCTTGGGAA
GTTTGCAGTTCATTGTAGCAACTCTCCTCTACACTGGAAT
AGTGATCTTTGCTCCTGCAGTCATCTTGAATCAAGCCACA
GGCCTGAACATGTGGGCGTCTCTTTTCTCAACTGGGCTCA
TCTGCACATTTTACACCACAGTGGGTGGCATGAAGGCTGT
AATTTGGACAGATGTGTTTCAGATTGTAGTCATGCTCTCT
GGGTTCATTGCAGTCTTTATTCAGGGCACTATATTGGCAG
GAGGGCCTGCCAGAGTTTTGGAGATTGCCAACAATGGATC
CCGTATCAATTTTAATGATTTTGCGATAGACCCTCAGAGG
CGGTACTCATTTTGGAGCTTCACAGTGGGTGGCACTATGG
TCTGGTTATCCATGTATGGAGCCAATCAGGCCCAAGTACA
GCGATACATATCGTGCAGGACTGAGAAACAAGCTCAGCTG
GCGCTGCTGGTGAATCAGGTGGGTCTGTGTCTGATTGTGA
GCAGTGCTGCCACCTGTGGAATTGTGATGTTTGCTTTATA
CTCCAACTGTGACCCACTGAAGATCGGCAGAATATCTGCA
CCTGACCAGTACATGCCGTACCTGGTTTTGGACATTTTCC
GGAATCATCCTGGCTTCCCGGGTCTTTTTCTAGCCTGTGC
CTACAGTGGGACTTTAAGTACCGTCTCCACCAGCATCAAT
GCCATGGCTGCTGTCACTATGGAGGACGTGATGAAGCCGT
GGTTAATCACCATTTCACAGAGAAAACAGCTCATGCTCTC
CAGAGCTTTATCGCTGTTCTATGGGCTTGGCTGCATTACA
ATGGCTGCACTCTCCTCTCTGCTGGACTGGGGAGTACTTC
AGGGTTCATTCACAGTGATGGGTGTAGTGAACGGTCCACT
GCTGGGAGCATTTGCCCTCGGCATGTTTGTTCCCGCCACA
AATAAACCGGGGGTTTTCTCAGGCGTGGCAGTGGGTTTCT
GTCTGTCTCTATGGCTTGCTGTTGGAAGCACGATTTATCC
TCCTTCACCACAAATTATGGGTGTTTTGCCCACTAGTGCT
GGACAGTGTCTGACAACTAATGCAACACTCAACACCACAG
CATCTGTCCTGGCTTCATCAGTCCCTCTGGATTACAGCTT
TCAAAACATCTATTCAATATCCTACCTGTACTTTGGAGCT
CTGTCAACTAGTGCAGTCGTGCTGGTTGGTGTGGTGGTCA
GTTATATTACAGGACCCACTAAGAAGGATTCTATCAGTCC
AGGTTTGTTACGGTGGAACTTGGAACAAAAGCCCTGCGAT
GCATCTTGCCATATTTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations