Transcript

cnr2-201

ID
ZDB-TSCRIPT-090929-9352
Name
cnr2-201
Previous Names
  • cnr2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026731 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026731|OTTDARG00000021122|ZDB-GENE-040702-7 cnr2|OTTDARP00000021914 cnr2-001 LG_ AL844887.10 Danio rerio protein_coding KNOWN, 1379 bp
ATGGAGAACAAACTGGAACAAGATCAAGAAGCTACGACTG
TGCTTTACTCAAATTTGAGTACACAGAACATTTCAACCAC
AGATAAAAGCTTATGCAATAGCCTACAGTGCTACATGGTT
TTGACCACACAAGAGCAGAAAGCTATCAGCTCAATTTGCT
TTCTAGCCGGCCCAGTGACTTTCCTGGCGAACATTTTGGT
CCTGCTGACCATTGCAAGCTCCACAGCACTGCGCAGACGC
CCATCGTACCTGTTTATCAGCAGCCTGGCACTGGCCGACA
TGTTTGCCAGCTGTTTCTTCACCATCAGTTTTCTAGATTT
CCATCTTCTCAGTCAGAGAGACGATGCTAACCTCTATCTC
TTCAAGCTTGGTGGCGTCACAATGGCGTTTACGGGCTCTG
TGGGAAGCCTTTTGCTGACAGCGCTGGACCGATATCTTTG
CATCTACCAGGCTTCCAATTACAAGCTGCTACTGACACGC
ACTAGAGCCAAACTGGCCATATTATTCTTATGGTGTGTGA
CGATTATTCTCTCATTCCTCCCTTTGATGGGGTGGAGGTG
CAAAACCTGGTTGGATCGTCCATGCTCACGTCTCTTCCCG
TACGTGGATCGTCACTATTTGGCCAGCTGGACGGGTCTGC
AGCTTGTGATGCTTTTTCTTATCATAGTGGCTTATGCTCT
TATCCTGTGGAAAGCAAATCGCCATGAAGCAAATATGGGT
GGACCAAAGTTAGGGAGGCAGAGCGTGAAAGGACAGGCTC
GAATGCGAATGGACATTCAGCTCGCACACACTTTTAGTTT
GATCCTTCTAATCCTGGCGATCTGTTGGCTGCCCGTCCTG
TCCTTTATGGTAGTGGACGTCAGAGTGACCCTGACAAACA
AACAACAGCGAATGTTCGCTTTCTGTAGCACACTGTGTCT
GGTGAACTCTTGTGTAAACCCTCTTCTCTATGCCCTGCGC
TGCCGAGAGCTGAGGGGAGAAATGCTGGCATTGATAGAAT
GTTGCAAGGCATGCAGGGAACATGCTTTGGGTCATACTCA
TGGCCAAATAACTGATAGCAGTTCTGGCAAAAAGAGCACA
AATCCGGCAGTGAGTGGTAGTAACCCAGAAATTGTTTCTA
GGAGTGCAGACAGGCAGCAAAACAGCATATGAATAATGTC
TAAAAGTCATATTTACTTGTCATTTTGTTTATGGAAGCAC
AATATATTGTTGGCCACAACGATATCGGCCGATATGTACA
ATATATCGGTTGTCTTATCAGTAAAGACAGATACATTATT
AGTTTTAATGTTATTGTTTTTGGCCTGATATAGTAAAGCT
GATGAATTGATTTTTTTGTCGATTGATGTATTTAGGATGC
ACAATATATTGCTTGCCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations