Transcript

lmna-202

ID
ZDB-TSCRIPT-090929-9305
Name
lmna-202
Previous Names
  • lmna-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026674 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026674|OTTDARG00000021090|ZDB-GENE-020424-3 lmna|OTTDARP00000021871 lmna-001 LG_ CR848742.8 Danio rerio protein_coding KNOWN, 4620 bp
GCGAGTCGCAGCACACACTCTTTCAGCAGAGTTTCAGCGG
GACACAGCAGCTGTAGGAGCTTCAATAACCCAAACTCTCT
CTCTCAGCTTTACCAGTATCAGTAGTTCCAGACAACCATG
GAGACTCCAGGTCAGAAACGAAGCAGCCGCGGTGGGGTGA
CCAATGTCCTGTCCCCTACCCGCATCTCTCGATTGCAGGA
AAAGGAGGACTTGAGCAACCTGAATGACCGTCTGGCGGTC
TACATCGATAAGGTTCGCTCTCTGGAGGTGGAGAACGCAG
GTCTGCGTATGCGCATCACTGAATCCGAGACGGAGATCAG
CCGGGAGCTGAGTGGCATGAAAGCGGCGTACGAGGCTGAA
CTCGCAGATGCCAGGAAAACACTGGACTCGGTGGCCAAAG
AACGAGCCAGACTGCAACTGGAGCTCAGCAAAGTGCGTGA
GGACTACAAGGAGCTGAAGGCCAGGAACGGTAAGAAAGAA
GCAGATCTGGAATCTGCTCTGGCCAGGCTGAAGGATCTGG
AGTCTCTACTGAACTCCAAGGACGCGTCTCTCTCCACAGC
TCTGGGGGAGAAGAGAACACTGGAGGTGGAAGTCAGAGAT
TTGAAAGCCCAGCTGGCCAAGTTGGAGGGCAGTCTAAACG
ATGCAAAGAAGCAGCTGCAGGATGAAATGCTGCGACGTGT
GGATGCCGAAAACCGAATCCAGACACTGAAAGAGGAGCTG
GAGTTCCAGAAGAACATCTACTCTGAGGAGCTCCGTGAGT
CTAAGCGCAGATATGAGTCACGTGTGGTGGAGATTGACAG
CGGCCGCCAGCAGGATTATGAGAGTAAACTGGCCGACGCT
TTAACTGACCTCCGCAACCAACATGAAGAGCAGCTTCGCA
TCTACAAGGAAGAAATCGAGAAGACCTACAACTCCAAGCT
GGAAAATGCTCGCTCTTCCGCTGAAAGGAACAGTCATCTG
GTTGGAGCCGCCCATGAGGAACTGCAGCAAACACGTGTTA
GGATGGAGGGTGTGAGTTCACAGCTCAGTCAGCTGCAGAA
ACAGTTGGCTGCTCGAGAGGCGAAGATCCGCGAGCTGGAA
GAGGCCCTGTCCAGAGAGAGGGATATTTTGCGCCGTCGTC
TGGAGGACAAGGAGAAGGAGATGGCTGAGATGAGACAGCG
CATGCAGCAACAGCTGGACGAGTACCAGGAGCTGCTAGAC
ATCAAACTCGCTCTGGACATGGAGATCAGTGCCTACAGGA
AGCTTCTGGAGGGAGAGGAGGAAAGACTTCGTCTGTCTCC
GAGTCCTCCTCCTGCTCGTGGGGTGACGGTGACCCGCTCC
TCTGGTTCAGGCTCTCACACTCGTGTGGTTCAGAGCAGCA
CCAGTCGCACATCCTCCGGCAGCGCCAAGAAACGGCGCTT
GAATGATAACGACAGTGATGCCTCCAGTGTGGTTGGAGGA
ACAGTGACCCGCACACGGATCTCCCAGCAAGCCTCAGCCA
GCGGCCGCGTCACCGTTGACGAAGTCGACCTGGAAGGAAA
ATTTGTGCGGCTTAATAACAAGTCTGACCAGGATCAGTCT
CTGGGTCACTGGCAGGTGAAGAGGCAGATTGGTTCTGGCA
CTCCCATCGTCTACAAGTTTCCACCCAAATTTAACCTGAA
GGCAGGGCAGACTGTCACGATCTGGGCTGCAGGAGCCGGA
GGCACCCACAGTCCTCCCAGTGACCTGGTGTGGAAGACCC
AGAACTCATGGGGCAGCGGTGATTTGTTCCAGACCACCCT
CATCAGCTCCAGCGGAGAGGAAATGGCGATGAGAAAAGTC
ACACGTACTCTGTTCCAGGATGAGGAAGATGATGAGATGG
CGGCTCACAGCACATGCGGAGACAGCGAGTATAACCTGCG
CAGCCGTACTGTGTTGTGCGGCTCGTGTGGTCAGCCGTCC
GACAGGAACAGCAGTTGTGTTTCTGCCAGCTCAGGAGTGT
CCAGCGCATCTCGCTCCTTCAGCAGTGGAGGAGGAGGAGG
ACTCACTGAAGCTTTTGTGTCACCCTCTCACTTTATTGTG
AGCAACGACAAACCCAGACAGGCTGGACCCAAAGTGGACA
ACTGCTCTATTATGTAGAGAGGCTGAAAACAAACCCTGAC
CATCTGTGCTTTCACAGAAACCAGGCGGAACTGATCCCAA
AACTAGTTTCTTTTCAGTTTTTTTATGTCTTATCATCACA
CTATAACATATTTGTACTTCAGTGTTTCTTGTTTCGTATT
TCATAATCTACCGGCTAGATTTGGCTTTTTGTATGGCAGC
TTGTAGGCAGTAGTTTGCGATTATTATGTAGAGTGTTACT
CTAAAATATAAATGCATGGTGGCAGCAGCAGCTTCAGAAT
GATGGTCCTGCACTCAGGGAGAGAGGCAAACTGAGCACTT
CACACTCACACCATGAGCTCTCAATGCTGTCAGAAAGCAA
CACGCACAGTCAACAAACCCTATCAGAAGCTCCAGTAAAG
TGGACTACAGTTGTACAGCACATAGGCTAGTTATTTAGCT
CATAAACACGGACAGTAAGATATAGTGAGTGTCGTTTAAA
GAGACAGTACACCTAAGAATGGACATTTGTTGAATTACTC
ATCCCAGGTCTTCCAAGATGTGACCTTTACTTCAGGAGAA
CTTTAAATAAGAGACATTTTTAGATATGAATTGTGATTGT
TTGGTGATTTGTAAAATGCTGTTCATTTTAAGAGTAAAAA
ATATATACAGGCAACACAAATTTAAATGCTGTAACTCCTA
ATAAACTGTAGAGAGGATTACATGTAAATAGTATTCAGTT
TCAGTTTGCTCCATAAGCAGTGTTGGGTAAAGTTCTTTTA
AAGTAATATATCACAATCATAACTTGTAAAAATGCCAAAA
TAACAACACATTCACTGAGTAACGTTTAGTTACTTAAAAA
AGAGAGTTAAGATTACAATATATTACTTTTAAAAGTATAT
TTACCCAACAATGTCCATAAAAACTCAATGTATCGTCAAG
AGAAAATGTGTATTAATTTAGTTTTACCTGTATATGTTGT
TTTATGACGCTCAAAGTTTTGTAGATGGTTGACCTGTGTT
TTATAAATCACCAAGAATCACCTTTTGAGCTAAAATCTTC
TTTAATGACTTCTGAACACAGAGATTCACCTTCATCTCGC
ATGGCCTGCGGGTGAGTAAATATAAAATCACATTTCCATT
TCATGGTGAACTCTACCTTTAATGGAAGACAGGAGAATGA
GGGGTCATTTTACAATATGTCGCCTCAAACTTCTGTTATA
GGAAGTTTTATGCTACCTCTCGCAGTCTGGTAGTCGAAAG
GATGTGCACCTACAAAAGGGAAAAGAAAAGTGAGAATGTT
TTGTGTTAAAGAGAGACTCGTGGATTAAATAAGTACAGAT
GCTTTGGAGACGGTTGAAACAGGTACTTGTGTTTTTTCTG
TGCGTTTACAAGCTCTGACTAGACTGCAGTATGTCATGTC
TTGTGTAATTAGTGTTATGGGATGTTTCTGAAAGACTTGA
AGCAACTATAAAACGCATCCAAAGAAGTTCTCCTTAGCAG
TTAGCATTTTTCAAGATGTTGTTGACATTTTACTCAATGG
CTTGACTCATTGGTTTAAAAGCAAAACTGAAGTTTACTTG
CAGAGAAAGATGTATTATGTTACCAGAGAAATCATGTTGA
ATTTAATATGATGTATTTTTGTTTTCAGCCTTAGAGGCGG
AATATTTAAATATGCAAAATGACCACCGTCATTCCCTGTT
TAAATTTGCATCTAATTTTTTTTTTTGTTGTACGGTGGTA
CTTTTGGTAAGTGTGCACGTAGACTAAAACGTTTGTGTTT
CTCTATCTCTGTGTCTTTGAGTGTTGATTTGCTCCCGTCA
CTTCTGCTCTCTTGCAGTAGATCTAGTTCCTCATCTGGTC
AGCTGTAAGCCTCTAGTAATTCTTCACTCACCTCCAGTCA
GTTTAGAGGATCAAATACTAGACTTAATAAATGAGAAATC
TAGAGCAGATTTGATCATAGGTGATTAAAAACATAAGCAG
AGCTACAGCTCTCCAGAACGAGGACTGTATAATGCTGGCA
TTAAACATGTATTTTATTGCTTCGCAACGCTTTGGGTTTC
TAAAGAAAAGTATTGGGATAGTATATCTATTTTTTCTATA
TATATATACTTATGAATTGTGGTAATTTTGCTTACATAGC
GTTTGACGTTATTGTAATAAGCCATGTATTTTGTTTTTCG
TTTTTGAACTGATGATGTATTTTCAGTTGTTTTGTTATGG
CAAATTTCTGTTTGGCATCTTTGGCTTATGCAAAGAAACA
CTTACTGATAGCTGTTGGTGCATTTTATTAGCAAACTTCA
AAGAAAAACATCTTTGTTTTCTTGATTTTGAGACTTGTTT
TAGTTAGATGGCTAATGTCATGAAGGTTTTGTAAAAAAAT
AAAATAAAGAGAGTTCTGACTGCAGGGCAATGCAGGGAAT
GTTTAGTTGATTTTTTATGATTATGTTTTATTGTTTTGTG
AGGAATTTCACAAAAAATGTCAAATCTGAGAGCCTTTGTT
ATGAACTGTGCCTTGATTTTGTTCAGTTAAATCAAATAAA
GCCATTCTGACTTTTTTCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations