Transcript

cdc23-002

ID
ZDB-TSCRIPT-090929-9270
Name
cdc23-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026637 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026637|OTTDARG00000021077|ZDB-GENE-040426-866 cdc23|no_translation cdc23-002 LG_ BX957298.9 Danio rerio protein_coding KNOWN, 773 bp
TGCTACTGGAGGGCTTATTCTGTTGGGGATGTGGAGAGAA
TGGCGCTTCTAAAACTGGCAAAGCTTCACGAGCAGCTGAA
TGAATCTGATGACGCCGCACAGTGTTACATAATCTACATC
CAGGACATTTTCTCATGTGGTGTAAGCTGATGTATTTCTT
TGTTAAAGGGATCGTTCACACAAAAACGTAAATCTCCTCA
CCATTTACTGGTTCTACATTTTTTTGAATTTCTGAACATT
TCATTCATAGCAGGGACACAAAATACAATGAAATCGATGA
CACTTTTCCCCCCCTTACAATCGTCAGTATTCGCCTTATT
CTCCGTATACCAGTGGGCGCAGCCATTTGAATCTTTTTGG
CTTGAGACTTCCGGTCTCATTCACTTCCATTCATTTTTAG
AGGTTAAAAACAGCTCGTCATGCTGCTAGATGTTGCAAAC
TGATGTTTTCGTATTATATTATTCTACTTTGTCTGTATAG
TCATGCAAACACTTGTTAATAGAGCAAGTAATTTGACCGT
TTTCTGTGTTTATTATTCCTAGTCATTTCTCCCATAGGCA
GCTGAATCGGAAGTTCTAAAACAATCGTAAAAATGAGGGC
ACTTCCGCATTGAAAAATAAGGTCAATATGCTTTCTAGTG
TTTACGGAAGAATGAAACTCAAGTTTTAATCAAGTAAATA
ATGGCGTAATTTTTATCTTGGTGGGAAATGTCATTTTAAA
TGCACAAACTATCATAAGGGCTCCTTTACACAAGTTTACC
ACTCTTTCATGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations