Transcript

cdc23-201

ID
ZDB-TSCRIPT-090929-9269
Name
cdc23-201
Previous Names
  • cdc23-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026636 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026636|OTTDARG00000021077|ZDB-GENE-040426-866 cdc23|OTTDARP00000021850 cdc23-001 LG_ BX957298.9 Danio rerio protein_coding KNOWN, 3622 bp
GATCAGTTTGACCAATCAGCTCTTGCGCTGGTGTGCGTCA
GTATGACGTATTTATGAAAAATGGCGGCTACCCGTTGCAG
CGATTTTGGCGACTTGGTCCAAATTAAAAAGCAACTTATT
TCTATTATAGCTCAGTGTAAAGAAAGAGGACTCGTCCACA
GTGTGAAATGGGCATCTGAACTGGCTTTTTCTTTGGATCC
ACTTCCTCTGAATGAAATCCCTCCACCACCAGAGTTAACT
GAGGAAGATGCCCAGGATTTGGATGCCCTTTGCCTAGCCA
AATCGTATTTTGACCTAAAGGAGTATGACCGAGCTGCGTA
TTTTCTCCGTGGCTGCCGGAGTCAGAAAGCATATTTTCTG
TATATGTATTCGCGCTACCTATCAGGGGAAAAGAAGAAAG
ATGATGAGACTGTCGACAGCCTTGGTCCACTGGAAAAGGG
TCAGGTCCGCAATGAAGCCCTGCGAGAACTTCGGGTGGAG
CTGAGCAAAAAACATAGTGCGGGAGAGCTGGATGGATTTG
CCCTGTATCTTTATGGCGTGGTTCTTCGTAAACTGGATTT
GCTAAAAGAGGCGGTAGAGATTTTCGTGGCGGCAACACAT
GCTCTTCCTCTGCACTGGGGATCATGGCTGGAGCTGTGCA
ATCTCATCACCAACATTGAAATGCTGAAGTCCCTGTCCTT
GCCAGACTGCTGGGTGAGGGATTTCTTCATGGCACACATG
TACACGGAACTGCAGATGATCAAAGAGGCGCTGCAGAAAT
ATCAGAGCCTCATGGAAGCAGGGTTCGCCAAGAGCAGCTA
CATCATCTCCCAGATTGCCGTAGCTTACCATAACATACGA
GACATTGATCAAGCCTTGTATCTGTTTAATGAACTTCGGG
AACAGGATCCTTTCCGCATTGAAAACATGGACACATTCTC
CAATCTGCTTTATGTCCGGAGTATGAAGCCTGAGCTCAGT
TACCTGGCTCACAATCTGGTGGAGATAGACAAGTACAGAG
TGGAGACATGCTGTGTCATAGGTAACTACTACAGTCTTCG
GTCTCAGCATGAGAAAGCAGCACTGTATTTTCAGCGTGCT
CTAAAGCTGAATCCACGCTGTCTAGGGGCCTGGACCCTCA
TGGGTCACGAGTACATGGAGATGAAAAACACTTCTGCCGC
CATTCAGGCCTACAGACATGCAATAGAAGTGAACAAAAGA
GACTACCGGGCCTGGTATGGACTGGGACAGACCTATGAGA
TCCTCAAAATGCCTTTCTACTCTCTCTATTACTACAGAAA
AGCCCATCAGCTTCGGCCTAATGACTCGCGTATGCTCGTA
GCTCTTGGTGAATGTTATGAGAAACTTTCTCAGCAATTGG
AGGCCAAAAAGTGCTACTGGAGGGCTTATTCTGTTGGGGA
TGTGGAGAGAATGGCGCTTCTAAAACTGGCAAAGCTTCAC
GAGCAGCTGAATGAATCTGATGACGCCGCACAGTGTTACA
TAATCTACATCCAGGACATTTTCTCATGTGGTGAGCAGTT
GGAGCATGCAGAGGTGAGCACTGCGCTGCGGTATCTCGGA
CAGTACTACTTCAAGAACAAACTGTATGACGAGGCGTCTC
TCTGCGCTCAGCGATGCTGCGACTATAATGACGCCAGAGA
AGAAGGAAAGGCTTTGTTAAGACAAATCTCTGCAGTGCGG
GAGCAAGGGGAGCCCTCGTCTACTGATCTGTCTCTACCAT
GTGTTTTCAACCCTTTGTCTAACAACACCACACCAGTTAG
AAGGGTATCTCCACTTGATCTGTCTTCTGTTACACCCTAA
CAAACACACGATACATTAACAGGTCAGATCTTTCACTCAG
CCGCACAAACATCAAGTTTATATGCTGAGGAAGAACAAAA
ATTCATGCCTTTATGTTCACCTCATTGTAAATAAGTGCTT
GTACAGACAAATGGTGCCAGTTATATTAAATAAAACAACT
CAACATTCAAGGGTCAATGTTTTATTACCAAAACCCTTTT
CGTTTTGATTATACAGTGAAAAGAAGAGACATTCAAAAGT
GACAAACATCTCACACTCATGCAAACTGTGCAAAACAAAT
GGACCCAACGCAAGAATGTAGTGCTTGTATCTGAGCATTT
GGTCCTTAATAAACATTCCAAAGAAAATCTTGTATTTGGT
TATAACACTGAAGTATTAAAGAATCACACAACTCTGCCAA
AAAAAAAAAAGAAGCTAAAATTTGGATGTAAAGTAAGGAT
TAACCTGGATTTCTGGTCAAACATACAGTTTAGAAACACA
TGTAACGCAGAATAATATTTAAAATCGCTCTAATTTTGTA
TTTACAGTTTGATTTGGTTTAAGTGAGGCATACTCGTAAA
AGAAATATATAAAAAATAGAGCATATATGAAAAGATGTGA
TACATAATGGTAGTATCACATGGCCATATTGTATAACAAA
ACCCCTTAAATAAAAAAAGAATGCCAGCATAACTATAAAA
AGTAAAAGAATCACTTTAATAATTTGTATGTCAACAAGGC
CACCTGATCATGTAATAAAAGACTGCAAGAGATAAAAAAA
ACAACAACACTAATTAGTATACACCCTTAATACTTGACTC
GGAGCATGACGGGAGTGGTAGGAGGCGATGGCTGTCGTGA
ACGCAACACACGAGAATAAGGTGTGGTGACCTCATTTTGC
TGTCGGGTTGGTCGTGAGGGGGTCTTTGAGGGCGTGCGGG
AGGGAAACAGCGAACGGAAGAAAGGGCGTTTTTCTGGAGG
CTGGTTCTCCGCCAGAGCTACCGCTACCCCGCAACCCCTT
TTCTTGCAGGAGCCGGATGCCGTTGGAGGCTGGTGGGACT
GGGCTTGTTGAGTGTTCTGGAAGCGCGTCAGGAGCTCGTC
TTTCTTACGCAGTTCCGCTTTGACCAGCTGCAGGCTCGTG
TGCAGCTCGACTAGCATTTGGTCCTACAGAATAAGAACGG
GAAGAGGAGAGGGCGACGAACAGGGTTAGAGAGGCCAGAG
GGTAAATAAAGAAAGGTGGAGTGGGAACTAGAATTACACA
CTGTTAAAATCTAATCCTCTGCAAAATCGCATCGATTAGA
GAAGGAAAACGTGGTGTTAGAGGGGATTAGCACGAGAAAC
AGCATGTCTGTGAAATTAGTGATGGTTTAAAAAAAAGATG
TGTTATCTTTCGCATGGTTTAGGCAAGTGTTTGATTTTAA
CGTGTGTAAAATCTATATCAGCATGAAGGGGTTAAAAGAA
AGAATAAAGGAAGAGGGGGAGAAATGGAAAATGTGTTGGT
GTAAAGACTAACTTACCAGACAGTCATAATAATTAGTTTC
ATTTATCACTCCATTTTATTATTAAAACAATTAAATGTAA
AGTACGGCCAAAAATCAAAAGTGAGTTACCATGTGCACTT
TAAATGCGGTATACCCATTTTTTTTTTTACATTGTACTAC
AAAAGTTGAGGTAAAAAAAATGTATAATAATAAGTCTTGC
TCACACTCTTTGATATACTGGCAGTAAAGACTGATTAGCA
TTGGGTTTTTTGTTTCAAAGAATGGTCTTATGTGGCATGT
CATATATTCCAATTGTTGTGGGTGTTATGATTGTGCGCAA
TGAAAAAACCAAAACCTTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations