ZFIN ID: ZDB-TSCRIPT-090929-9259
Transcript Name: rbm38-202
Previous Name: rbm38-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026625 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026625|OTTDARG00000021069|ZDB-GENE-030131-5923 rbm38|OTTDARP00000021840 rbm38-002 LG_ CR450824.10 Danio rerio protein_coding KNOWN, 877 bp
AGCGCGCGGTCATTCAGTTGTTCACCTGCCGTCATTGTGT
CTCCGGACATGGACTAGTCTAGCGGACGAGTTTGCACACG
AGGAGACGAGCCGGAGCCACAGTCGTGTTTCCCAGCCAAA
GGACTGCATCTACCTCGCTGCCTTCGCAAACGCCGCAGAC
TAGCTGAAGAAGCGTTTGTTATTTATGTTTATTTATACTT
ATTTATAACATTTCCCATTTACATTGCACTGAATTTCGAG
CACAGATGCTTCTACATCAGTTCGTGAATGGGACGTTGGA
GACAATGTATCCCAGTATTCAGAAAGACACGACTTTCACC
AAGATCTTCGTCGGCGGTTTGCCGTATCACACGACAGACG
CGTCGCTCCGCAAATACTTCGAGACTTTCGGCGACATCGA
TGAAGCGGTGGTCATAACGGACCGACAGACGGGCAAATCC
AGAGGATACGGCTTTGTCACTATGATGGATAAAAGTGCAG
CGGAAAGAGCTTGTAAAGATCCCAACCCTATTATTGATGG
ACGCAAAGCTAATGTCAACCTGGCGTACCTCGGGGCCAAA
CCACGCAGCCCACTGACAGGTAAATTCCAGCTGAACTTCT
TCAATGCTATTCTACTGGAGTCCAGCAGGTCCATCCGACC
CTCATCCAGAGGCAGTATGGACTCAGCCAGCCATATGTTT
ACCCTCAGGCCGTCCTGCAGCCCAGTCTGCTTCTGCCCAC
ACAGGTCTCCTCCACCTCCAGCAGCCCTTACCTTGACTTC
AGCACTGCCTACGCCCAGTACGCCGCCTCCGCCTTCGAGC
AGTACCCCTACGCCGCCTCGCCAGGGTTCCTCAGCTACAT
GTACCCTCCAGGCACCGCCGGGCCATCCTCCGCCATC

rbm38 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rbm38-201 (1)    Ensembl 2393
rbm38-202 877
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbm38-202 Contained in:
[BAC] CH211-147F12 (1)

Genome Resources: Vega_Trans:OTTDART00000026625 (1),  Ensembl_Trans:ENSDART00000121480 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO924743 (1) 850 nt
CITATIONS (2)