ZFIN ID: ZDB-TSCRIPT-090929-9246
Transcript Name: ywhabl-201
Previous Name: ywhabl-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026612 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026612|OTTDARG00000021060|ZDB-GENE-030131-448 ywhabl|OTTDARP00000021831 ywhabl-001 LG_none CR848666.4,BX005256.11 Danio rerio protein_coding KNOWN, 1882 bp
TTGGCGGGAAACCCCGTGGATTAGCCCGACCGACAGCCCG
TGAGGATCAGCTGAGAGCCGCGGTTAGCTTAGCTCAGACA
GGACCATCGTTATTCCCCGACACTCAGGTAAGAGAACACA
CCATATCAGGATCAGTGCACTCTGAGCAGCCATGGACAAG
AGCGAGCTAGTGCAAAAAGCCAAGCTGGCCGAGCAGGCAG
AGCGCTACGACGACATGGCAGCCGCTATGAAGGCTGTCAC
TGAGGGTGACATTGAACTGTCGAACGAGGAGCGCAACCTG
CTCTCGGTGGCTTACAAGAACGTGGTGGGTGCCCGTCGCT
CATCCTGGAGGGTCGTCTCCAGCATCGAGCAGAAGATGGA
GGGTAGCGACAAAAAGCAGCAAATGGTCAAGGAATATCGG
GAAAAGATCGAGAAGGAGCTGAAGGAGATCTGCAATGACG
TACTGGTTCTTCTGGACAAGTATCTCATCCCCAAAGCGAC
CCCGGCTGAAAGCAGAGTCTTCTATCTGAAAATGAAAGGC
GATTACTTTCGCTACTTAGCAGAGGTGGCTGTGGGAGAGG
AGAAAAACTCTATCATTGGCAATTCGCAGGAGGCCTACAA
GGATGCGTTTGAAATCAGTAAGGCAGAGATGCAGCCCACA
CACCCCATTCGTTTGGGTCTCGCTCTCAATTTCTCCGTAT
TCTACTACGAGATTCTCAACTCACCCGAACAGGCCTGCAA
GCTCGCCAAAACAGCTTTTGATGAGGCCATTGCAGAGCTC
GATTCACTGAATGAAGAATCCTACAAAGACAGCACATTGA
TCATGCAGCTACTGCGGGACAACTTGACACTGTGGACTTC
AGATAACCAGGGCGAAGGCGAAGACGCCGAGGAAGGCCAA
GAAAACTAAGTCTGGCTCTGTCCGTCCTTCCCCCTGTCAT
TCACCTGCCATCATTCCAGCTCACCATCAAACACTGAGAC
CACCTCATCATCCACCTCTCTCTCTCTCTTTTAGTTCTTT
TACTCTCGCGCCTTCCTTTGCTTTCTTCCTTCCCTGTCAT
TGTGGGTTTTTTTTCTAAGGATTTGTGTAACGGGAGGAGG
GTGGGATGGGTTAATTAAGCGGGGTGGGTGGGCGCTCGAG
ATGCGTTGGGTCGGAACAAGGGACTGGGAGGGGATGAGGT
TTTGTCTGCCTTGTTTTCTCCGTGGGTCGTTGCTTTAGCG
TGGATGAATGCGGGTGAGGGCAAGTTCTCAGCTCATGCAA
AGTTGCAAGTCAAACCCTTTTGTTATTCGTATACTGTATG
TAAAACTCAGTTCAGGGGTCTGTGCGTTTGTCGTACAGCT
GCAGTTTAGCGTCTGCATTAAATAAGCCCTTTTCTTCTAG
TAGAAGTGAGGTTAGCAGTGCTAGTCTTTAGCTAGGAAAG
AAGCAACTGTTTGCTCACGTCCTGTAAAATGATGGGCAAA
AGAAAAAAAGGTTACATTCCATTTATTGTCATTTTCAAAT
TTCCAATTCCAGGAATTTGGTGCCCTGCAAGTGGCATTTA
TATTTTCCCCCCGTTAATCACGAGGTATGGAGGACCCAAG
AACAAAGAGCACATAAGCTTGATGCTGTTACTGTATGACT
GTACAAGCCGAGTAGTTGGATATACTATTGTAATTTTTGT
TTTTCCAGGTATGGTTTGTTTTTATTTTCTTATTTTTTTT
TCTCCATTGATTTCTTTTGATACTTGCCTAATTTGCATGT
GGCTATGAAGTAGTTAATATGGGGAGGAAAGGGAGATTGT
CGGGCCGGCTAGCTTTGTGTCATGTCTCTGGATTTTTTTC
ATACAGAACACCCAAGCATAAATGTTATTTGGAGGGAAAA
TATGTAATTTCATGTAAGTGGATTAAAAATAATTTAACAC
AA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ywhabl-201 Contained in:
OTHER ywhabl-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026612 (1)
  • Ensembl_Trans:ENSDART00000058956 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC065346 (1) 1837bp
    GenBank:BC059441 (1) 1764bp
    GenBank:EE698796 (1) 902bp
    GenBank:DV590311 (1) 823bp
    GenBank:CK357358 (1) 797bp
    GenBank:FP224283 (1) 660bp
    GenBank:EB765293 (1) 392bp
    CITATIONS (2)