Transcript

hif1al2-201

ID
ZDB-TSCRIPT-090929-9231
Name
hif1al2-201
Previous Names
  • hif1al2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000026595 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026595|OTTDARG00000021049|ZDB-GENE-050211-2 hif1al2|OTTDARP00000021817 hif1al2-001 LG_ BX530031.5 Danio rerio protein_coding KNOWN, 2522 bp
TCTGTGAGTATGTTAATTTATCCTAACATGAGCGAATGCC
ACCTGCTAACATGCCTTACACAAGATCACTTTGAGTCATC
TATACTTTTGAAATGACTTCAATGAATTTGGAAACAGGAG
GAGAAGACTGCCACGGAAAAGCTAGAAGAAAGCAAACATT
CATCGAGCAGAAGAAAAGGAGAGTCTGCACAGAATGGAGA
AAAACATGTTCCCGTTTGGCAGCACAGAGCAGGAGGAAGA
AGGAGAGTCAACTGTTCAAAGAGTTAACTGCTCTTCTGCC
TCTGGACTTGAGTATGGACGGTCAGCGAGACAAAGCTTCG
GTAATACGTCTCACAATTGCTTACCTGCACCTGAGGGGTC
TTTTGGACACCACAGACTCCTTGATGAAACGTCCTTCACC
AGGAGTGTCGGATAAATCTCATGAGAGGGAGTTGCTAGAT
TCTGCCCTCGGAGGGTTTGTGGTTTTGTTGTCTTTGAATG
GCAAGGTCATCTTCGCCACTAAGGGCTTAACTACCCACAC
AGGAATTAACCAGATGGATCTGATCGGAAGGAGCTTGCTT
GAGTTCTTGCACCCATGCGATCAGATGGAGGTCAAAGACA
TCCTCACGAGACTGATTGGGAACCAAGAACCACAAAAATG
TGAAGTGTTCCTCAGGATAAAAAAGGCAATGAACACGAAA
CTGACTGGTTGGAAAATTATTCAGTGTTCTGGAAAGAAAA
GGTCATCTGCTACACCTGGATCCAGTTGTCTGGTTCTTGA
GTGCAGGGTTCTGCCCATTCAGGAGATCACAGAAGTGGAT
GAAGCATTGAATGCATGTACATTTATGAGCGTTCACAGCC
CTGACATGACGTTCACCTACTGCCACTCAAGGGTCGTGAA
ATTGATCGGCTTTCGAGACACAGATCTGTTGGGTCAATCT
GTATACCAGTACTATCATCCATCTGACTGCCAGCAAATCC
GCAAGGCACACATTTGCTTGCTCTCCAAGGGTCAAGTGTC
GACCGGGAAATACCGGCTGCTGCACAGATATGGAGGTTAT
GTGTGGGCAGAAACAGACGCCTCACTGGTGTGCAACAGTC
AGACTGGTGTGCCAGAGAGTGTCGTCTGCATCAATTACAT
TCTAAGTGAAGTAGAGCAGCCCAATTTGCCATTTTTACTG
GAGAAGACAGAACAACTTCTGAAACCAACATCTAGCTCCT
ATTGTCCAGAGACAGAACCTGCCCCTTTTCCGCCATCTAG
AGGCCAGGAGGGTGAGAAAGATCTCAAGGAATCGAACGAA
CACAACAGTTTTATAACACATCTGAAACAAAGAGATGGTG
ACATACAGGAAGTTGAATGTACAGAGATCCCACATAACAC
AGAAGGGTGTTATGATTTCAATTGTGATCAGTGTGAGTTA
GACTTGGACAGTCTTGCTCCATACATTCCCATGCACGGAG
AGGACTTCCTGCTAACTCCCATTATAGACAGGGCGATGGA
CATGCCAGAATTAAACACGTGTAGACCATCATGTAGCAGT
CCATCTCAAAACCTGGATTCTTCAGAGGGAACAACCGTTC
TGCCAGTGAAGAGTCTTAATTCTACCCAACAAAGTGTCAG
TAATTCTTTTCAGACAAAAAGAATCAGCGATACTAACCTG
ATATCAACCAAGCAGTGGAGTGACAGCTTTGACCTTGTCA
ACAAAGTTTCAAAGGTTTATGATTACGATCCTAAACAACA
TAATTATCAACTATTTTCATCTGAAACCAAGGCAAATCAT
TGGGTGGAGGAGGCTCTGAAATTTCCACAACCCAACAGAG
TTCATTGGAACATCGATGGATCAACACCACCATGGATATG
TGACGGACACTTGAATCATCTTGAACCGAAGTTCAGATCA
CTTCCAGAGAAAACCAATTGTCCTCCTCAAAAGAGAAGAC
ACCAACATGAAGTAAAAACAGCCGCGGCACTTTTGACTCT
GCCTGTGTTGAGCGGATGGGAGTGTGAAGTCAACGCTCCT
CTCGAACACACATCATATTTACTCCAAGGGACAGAGATTA
TGGCCGTTCTGGACCAAGTAGCCTCCAGAGTGCCTTGGTG
CTGATGATTCAAAACAAAAGACTTAATGTTTATGCTTGGT
CAGCAATGCGCTTTTATTATATCAATGCCTGTGCGATAGG
AGTAATGGACTATAGTGTTTTTCAGTCAACGATGAACGTC
CGGTGAAAGTCTATTCTGGTGTGACTATTTTCAAATTCAT
AAGGTTCCTTTTACAGCCTTGATGTTGTAATGTAGTTAAA
ATAATTTGTATGGGATGACAATTAACCAGAAGCCCTGGGG
CTGGCTGACTGAAATTAAAAGTCTGTGTCCATGTACCCCA
TTATTTTATTCATCTAATAATGAGATTGTAAATGACTATG
TTGTTGATACACATGACTGGTCAAAGAATCAGTTTAAAAC
AACAGGATTGTGTTTAAAAACGTCTCTTATGCTCAGTAAA
CCTGCATTTATTTGATGCAAAGTAAAGCAAAACAGTAAAT
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations