Transcript

ndr1-201

ID
ZDB-TSCRIPT-090929-9191
Name
ndr1-201
Previous Names
  • ndr1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026522 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026522|OTTDARG00000021006|ZDB-GENE-990415-256 ndr1|OTTDARP00000021756 ndr1-001 LG_ BX927332.8 Danio rerio protein_coding KNOWN, 1592 bp
GCCACTTCAAAGACCCAAAACGACCTCACTGACCATCAAA
AGACTGCAAGTTTCTATAAGTGAACTTAGATGACCGGCCA
GCACTCATGACATTCACTTTCCAGAGGACGGTGTAAGAGA
AAGAGCTCAGAGACTTTATTTCAATAACTGCGTGTGGATT
ATTACCTTGATTTGACATGTTTTCCTGCGGGCTCCTGAGC
GTAGTTTTGGCCCTCGCGGTCGGCCTGGTGAGCTGCACGG
GAAACCTTGCTGGATTTCAAGAGACCCTCAGGAATAAAAT
GCGAGCAGCTGGCAGAAACGGCGGAGGTCGGGCAGGTCAC
GGCCGACATCTGACCAGATATCCGCTGTATATGATGCACC
TCTACCGGACACTTCTGACTGGAGACGAAAAACATTTCAG
CCATGAGAATCCAACTCTTTACGAGTCTGACTCCGTCTTG
AGCCTCGTCGCTAAAAGTTGTCATCAGGTTGGTGACAAAT
TCGCAGTGACATTTGACATGTCCTCCATATCAGCAAGCGA
TGATGTCCAGCGAGCTGAACTTCGCATTCGGCTTCCGCAT
CTCAGGTCTGAGTTGGAGGTGGATATTTATCACGCATCTA
CACCTGAGTGTGAGAGAAGCCCCTGCGAAGAAGTCCGGGT
CCACCTCGGAACCTTGAACGCAAACCCGATTAACTCAACC
TTCCGCTCCTCTTGGAGGATCTTCAACATCACTGCGCTCC
TCAAGTACTGGTTGCACCAGAGTGAGCGTGTGCCGTTTGA
GGAACCCACACAAATGCCGCCAATGGCTGAGGGACACAAG
AGCGTTCATCATCCTACAGTGAACCGAGTGATGATGGTGG
TTTACTCCAAGCAGAACCGGGCAAAGACGTCCACTCTCAT
CCGGACTGCCGAGCACTCCAAGTATGTAGCTCTGGATCGG
GCTGGTGGTGGAAGTGAACCTGTGCCTCGGCGCCACAGAA
GGAACCACAGAACTGATGATAGGGTCCGCGATGCAGCAGC
AGGGATGATTCCTGGTGTTTCCCATGAAGGTGGAGAGAAG
AAACCTCTCTGCAAGAAGGTGGATATGTGGGTGGACTTTG
ATCAGATTGGTTGGAGCGACTGGATTGTTTATCCAAAGCG
TTACAACGCTTATCGGTGTGAAGGCAGTTGTCCCACACCA
GTAGATGAAACCTTCACTCCAACAAACCATGCATACATGC
AGAGTCTTTTGAAGCTGCACCACCCAGATCGCGTCCCATG
CTTGTCCTGCGTACCCACCCGTCTGGCTCCACTCTCCATG
CTCTACTATGAGAGTGGCAAGATGGTCATGAGACACCATG
AAGGCATGGTTGTTGCAGAATGCGGCTGCCACTGATTCTC
CAAACCCCAAAGGAACTCAACTCTAGCACTTTGGATATGC
TCCTCGACCCCAAAAATATGTATTTAAGAAAAACTGCTGT
CAATTATTCCCACTTGAAATTATTATGGTTTCCTGCACTG
AGGCACCTGGATAACTTGATGCTATTATTGAAAGCTTTGC
GTGTTTGCCTTATCTGTAAATAGTAGAGTATGTAAATTAC
CAAATGTAATAAAATGTTTTCATAATGTTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations