header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9184
Transcript Name: rbp4l-201
Previous Name: rbp4l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026513 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026513|OTTDARG00000021000|ZDB-GENE-030131-7591 rbp4l|OTTDARP00000021749 rbp4l-001 LG_ AL844141.7 Danio rerio protein_coding KNOWN, 1459 bp
AAGCCTGTCTGTGGAGTTGGTATAAAAGGGCTCTTGGTCA
GTTTAGACAACACAGCCTTGTGGAGAACCACAAAGAAGGA
TCCTACACTACTAAAACCATTCTTTCATTCATTCAGGACA
TCATCAAAACAAGCAGAATGGGATTTTACAAGTTTGCCCT
GCTGGTGGTTTTCCTGTCATACATTGAGCGCTGCTTTTCT
GCATCCTGCGCTGTAGAGAGTTTTACAGTCAAGGACGACT
TTGACCCCAAGAGGTATGCAGGCAAATGGTACGCTCAGCA
GAAGAAAGACCCAGAGGGACTCTTCCTCCAGGACAACATC
TCTGCCGAATACACAATCGATGATGATGGAACCATGACTG
CCTCGTCCAAGGGCCGAGTAACTCTTTTCGGATTCTGGGT
TGTGTGTGCTGACATGGCTGCCCAGTACAGTGTGCCTGAC
CCTACCACTCCTGCCAAGATGTTCATGAACTACCAAGGCC
TGGCAAGCTACCTGTCTAGCGGAGGTGACAACTACTGGGT
CATCGACACCGACTATGACAACTATGCCATTACCTATGCT
TGCCGCACTCTGAAGGATGATGGCTCATGTGATGACGGAT
ATTCCCTGGTCTTTTCACGTAACCCCCGTGGCCTGCCTCC
AGCAATCCAGCGTCTTGTGCGCCAGAAACAAGATGAGATC
TGCATGGCTGGTCAGTTCCAGCCTGTGCTGCAGTCTGGTG
CTTGCTAAACTGTTTGAGGAAACAAAGAGGGATTCCTTTA
GCGTGCTGGCATAAGAAGCGGATTCTGGGGCCATTCCATT
TCAGCGCTGTAGAGGTGCATGTGTGCATCAGGGAGCCTAA
GATCTTTGAAGTTATCTCAAGGGAATGTTGTATTCTGTAA
AGTGTCTATGACAATAAATATTTTTTAAACAAAGCCTATT
TTGCATTGCTTTCATGGATTTTGGTGTGGCGGATGATTGT
GTTTGCTTTAAATGTCCTCGATATCTTTAGCCACAGGTGA
TTATGAGAGGTCACTGGTTTAAGGCATGGTCACACTGCAC
TTTTTGCCTCACTGATTTTCAATCATAAACATGCGATTTT
AAAAACAAGCTAGTTTGACAAGTTTTGCATTTTGCTGTGT
TCCAAAGTTTAAGCTTGGTGAACTCTGACCTGCAAATTTG
CATTGTGTGAATGCATGAGACCAATAGAAGACCAAAACCT
GACCTCTCTGTACAGAAATTTTAAATCTAGAGGAATTGCT
CATTTTATCAGTGTTGATATATCTTGTTTTATCACACCCC
TTTTAATAGCACCATCTGACTGAATTTCACATTCTCAAAC
TGTGTAGTGTGACCATGGCTTTAGTCTGATTTGAAGTTAA
CCTAAAAGTAAATGGGCTGTTTTAAAAGCAAAAGTAAAAG
AGCAGTTATTGTATTGTATGTGACATGAAACTCTGATCAT
AATTAAAGAACATTTTTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbp4l-201 Contained in:
[BAC] DKEY-30K6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000026513 (1),  Ensembl_Trans:ENSDART00000065659 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC059516 (1) 854 bp
GenBank:BI671087 (1) 534 bp
GenBank:EB866999 (1) 252 bp
CITATIONS (2)