header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9176
Transcript Name: nkx6.1-201
Previous Name: nkx6.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026505 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026505|OTTDARG00000020995|ZDB-GENE-040718-178 nkx6.1|OTTDARP00000021741 nkx6.1-001 LG_ BX000991.8 Danio rerio protein_coding KNOWN, 2023 bp
ATTATCTCCCAGATCTTCATGTGAACTACCCAGAAAGACT
CTCTTTTTATTTATAGATTTCAAAAACACTCTTTTGAAAG
GACGACGCTCTGTTGTATCATGCAAGATCTAAAAGAACAG
AATGGATATTGGCCAGAGGAGATGAGTATGAAGCTCCAGT
ACAACTGATTGGGATTTTTTTAGAGAAATTACTTTTTTGG
CTCCATATCGCAAGGTGTCTTTTGTTTATTTTTCGTTTCT
CCTCTTCATTTAGTATTCTGCGTTTGTTTTCACGTTTTCC
CGGGTCACTGTCCTGCTTCTTGCGCGATATTTAGTTAAAG
TTGTAGTTTGTGTCTTGGTTATGTTAGCGGTGGGGCAAAT
GGACGGGTCTCGCCAAAGCGCTTTCCTACTCAATACCCCA
CCTTTAGCTGCTTTACACAGTATGACCGAGATGAAGACGC
CGCTTTACCCAGCCTACCCGTTATCTTCCACTGGACCAGC
ATCCTCCACTTCACCGACAGCTACCTCTCCGAATCCAGGT
GGGATCCCGGTCTCGTCCCCGGGGATCAAAACCTCCAGTG
GACTTTCAGCTCTCGCATCAGCCCAGCAGTGCGCGATCGC
CACACCTCACGGAATAAACGACATCCTCAGCCGACCCTCG
GTGGCTTGTTCTCCCGCAGGAATCTTGTCTGGACTGCCCC
GTTTCAGCAGCCTGAGTCCCCCACCGCCTCCAGGGCTTTA
TTTCAGCCCTAGTGCCGCGGCTGTAGCGGTGGCTCGCTAT
CCCAAACCCCTGACAGAGCTTCCCGGCAGAACCCCGATAT
TCTGGCCTGGAGTTATGCAAAGCCCACACTGGAGAGATGC
CAGATTTGCGTGCTCACCACATCAAAACTCAGTTCTGCTC
GACAAAGATGGGAAAAGGAAACACACGCGACCGACGTTTT
CCGGGCAGCAAATTTTTGCACTGGAAAAAACATTTGAGCA
AACGAAATATTTAGCCGGCCCTGAAAGAGCCCGACTAGCC
TACTCTTTAGGAATGACAGAGAGTCAAGTCAAGGTGTGGT
TTCAAAACCGAAGAACAAAATGGAGAAAACGGCACGCGGC
TGAAATGGCCTCGGCGAAGAAAAAACAAGATTCAGAAACC
GAGAGGCTGAAAGGAGCTTCGGAAAATGAAGACGACGACG
ACGACTACAATAAACCTTTAGACCCAAACTCGGACGATGA
AAAAATTACACAGTTACTGAAAAAACACAAACCGAACACA
GCTCTTATCATTCACACGTCGGAAAACGAGAGCTCGTAAA
AAGGAAACGGGAAATGGGTTGTCAGATTCTTCAAGAAGTG
TCAAAATTAATATAGGCTACTTTTCCCCCACCAAGTTTGA
GCTCTGGTTTGAGAGGAAGGATGCAGATCAGAGGAATATG
CACTATTGGTGGAACTGAACGTGCATCAGTGTCTGCTATA
GACACGTTTCAACATAAAGACAACGGTACTTTTTTGTAAA
TTAACAGCGTGAGTTGTATCGCATAGGAATTATATTACTG
TGAATATTTATGTGTAAAATATTTTGAATAGTAAACATGA
CAGAATTCGTTCACTTCGCTTCAGTTTAATTTTTGGTTAA
GGCTTTGTGATTTGCATTTTTTTCATATCATTAATTTGTG
TAGGTGCTTATCACCACGAGTTATTTTATTTTTTCTCTGA
GTGTAAGTTCCCTCAACCATTTGATCTTTAAAAATAAACA
ACAATAGAAATATATAACACCTTTCAGAATTTACCACACT
AATGGCAAAAGACATGAGCGACAGCTCAAATTGAGGCTCA
GTCAAAAGATTTATCTGGCTTTAACAAGTGTAAATACAAA
CACCTAACCGTATATTTGTAATATAATGCATAGTGTTCGT
CTCCCAATGTTAGGATGTTTCTTTTATTTTCCCCCATGAT
TAATTTATGATATTTTAAGTTTGTAACAGTGTTTTGGATC
CTGCAAAATGCGCCATGCAGGTTCGTGTGTATTGCACTTT
TATTTAATAAAATGTTAAACGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nkx6.1-201 Contained in:
OTHER nkx6.1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026505 (1)
  • Ensembl_Trans:ENSDART00000029874 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076337 (1) 2045bp
    GenBank:AY437556 (1) 2039bp
    GenBank:CT637530 (1) 320bp
    CITATIONS (2)