Transcript

cdk9-201

ID
ZDB-TSCRIPT-090929-9149
Name
cdk9-201
Previous Names
  • cdk9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026475 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026475|OTTDARG00000020971|ZDB-GENE-030131-321 cdk9|OTTDARP00000021715 cdk9-001 LG_ BX530036.7 Danio rerio protein_coding KNOWN, 1782 bp
CGGTCGGCAGGTGGTGGTAACGTGTTTTTGCGCCGCTGAA
TCCGTCCTGGGAACCGCAGAGGAACAGCAAGGATGCAGCG
CGACAAAACCGGAAGCTCTGGCGGCGGTGAAAAGCCGGAC
AGAGAGACCGCCATCATGTCCAAATACTACGATGGCGTCG
AGTTTCCCTTCTGTGATGAATTCTCCAAATATGAGAAGCT
GGCGAAGATCGGACAGGGCACCTTTGGAGAGGTCTTCAAG
GCTAAACACCGACAGACGGGGAAGAAAGTGGCCTTGAAGA
AAGTTCTGATGGAGAATGAGAAAGAAGGGTTTCCCATCAC
GGCTCTGAGGGAGATCAAGATCTTGCAGCTTCTCAAACAC
GAGAATGTGGTCAACCTCATCGAGATCTGCAGAACAAAGG
CCACCCAGTTTAACCGTTACAAGGGCAGCATTTATCTGGT
GTTTGACTTCTGTGAGCACGACCTCGCTGGACTGCTGAGC
AACGCTAATGTTAAGTTCACTCTGGCGGAGATCAAGAGGG
TCATGCAGATGCTGCTCAACGGACTCTACTACATACACAG
AAACAAGATCCTCCACAGAGACATGAAAGCAGCCAATGTC
CTGATCACCAGAGATGGTGTCCTGAAGCTGGCTGATTTCG
GTCTGGCCCGAGCCTTCAGTTTGGCTAAAAACAGTCAGGG
GAATCGCTACACAAATCGGGTGGTCACTCTGTGGTATAGA
CCGCCTGAACTACTGCTGGGCGAGAGAGACTACGGGCCTC
CCATAGACCTGTGGGGCGCGGGGTGCATCATGGCGGAGAT
GTGGACCAGAAGCCCCATCATGCAGGGCAACACAGAGCAG
CACCAGCTCACACTCATCAGTCAGCTGTGCGGATCCATCA
CTCCTGAGGTCTGGCCGGGTGTGGATAAGAAGTATGAACT
GTATCAGAAGATGGAGCTTCCTAAAGGGCAGAAGCGTAAG
GTGAAGGACCGGCTGAAGGCGTATGTGAAAGACCCTTACG
CTCTGGACCTCATAGACAAACTGCTGGTTCTGGATCCGGC
GCAGAGAATTGACAGTGATGACGCTCTCAACCACGACTTC
TTCTGGTCCGACCCCATGCCCTCTGACCTCAAAAACATGC
TCTCCACACACAACACCTCCATGTTTGAGTATCTAGCCCC
GCCCCGCAGAAGAGGTCACATGCCTCAGCAGCCGGCCAAT
CAGAACAGAAACCCAGCCACCACCAGCCAATCAGAGTTCG
ACAGGGTCTTCTGATTAATCTGTAATTGGTCGAGGAGAAA
GAGACTTATTTAAATGACTAAATATACATTTCAGCACATC
TTGGCTTGGAAATCCAGGCAGATGCATAGAAATCCTGGAG
TTTACCATCTGCACTCACTATTGTAATTACAAAAAATACT
GATTGTGGATCAGATGAGTTCTGTTGATGAAACTTTTGAT
GCTTTATTATGGAGCTTCAACACTTTTGAGAAATGAGTGT
ATTATTGTGCTGCCCCAGTGCATTGTGGGAGAGAAAAGAA
GTGTACTTAGTGTATTGATGCACAGATTGTGTTATTGGAT
GTGAGTCTCCTGAGAAGATGATTTTGTATTGTAAAGAGCG
ACACGCTACTTTTGTCTAGGAGACATTTATTTAAACCCTT
CACTTCTCTTGACAGATTTTATTGTTAATTTAGCTGCTTA
TTTTTAAAGATGTTTTTATTTGTAAGATCACGTGTTCAGG
GTCATGGTGTTTGTTACTTGTATAAGTATAAATACACCAA
TAAATCCTCCACATTTCCCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations