ZFIN ID: ZDB-TSCRIPT-090929-9092
Transcript Name: neurog1-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes: neurog1 (1)
SEQUENCE
OTTDART00000026417 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026417|OTTDARG00000020942|ZDB-GENE-990415-174 neurog1|OTTDARP00000021674 neurog1-001 LG_ BX571940.12 Danio rerio protein_coding KNOWN, 1393 bp
CTCACACGAGCTGATTGAGGGTTAAGAGCAAGACAGACGC
GTGCCATTATCTTCAACACAAACTATCTGCAGGATTCTGC
AAAACCTCAAGCATCTCCCAGCCCACCAATAAGGTTATCA
ACAATGGAGATCGTATACTCCGATATGGAAACCTCAAGCT
GTGACTACTCCTTTTCGCACACGGATGATGAGGACTCGCG
CAGCAGCCTCCACCCCGCGTCCCCCGCGTCCTCCTGCGGA
AAACCACCTGCGTCTCCAGCCGGGCTCCAGCAGAAGAAAA
GGCGCAGGGGGCGCGCGAGGAACGAAACCACTGTGCACGT
CGTGAAGAAGAACCGCAGGCTGAAGGCCAACGACCGCGAG
AGGAACAGGATGCACAACCTTAACGACGCATTGGATGCTT
TGAGAAGCGTCCTGCCTGCGTTTCCTGACGACACAAAGCT
GACCAAAATTGAGACTCTGCGCTTCGCTCACAACTACATC
TGGGCACTTTCGGAGACCATCCGGATCGCAGACCAGAAGC
AGGGCAAGTCAAGAGACGGTCCGCTGCTGCTCCCCGGACT
AAGCTGCATGGCAGATGCACCCAGCCCCGGCAGTGACTCT
TGCTCCTGGCCGTCGGGGGCATCCTCGTCGTCTTCATCAC
CGTCTTACTGCAACTCAGACCCGGGCAGCCCCGCAGCCAT
GGACGATTTTGGATACTTGCAAACCGACGTAGTGTACAGC
TACCGCAACTTCGTGCCTAGCATCTATTAATGTGACTTTA
AGCGTTCTCATGTCGGTATAGAATCTCCAGAAGTATGTAG
TAGTGTAAGACCACTGTTACTTTTCTATTAGAACCAAGAG
CACAACGTTAGGTATTCACTGTTTGCCTTAATGACAGTCT
GCAAATGAGAATGTTTTATTTTTGTACGTTTTGATATTGA
TGTTGATGTTGATGCTTTTTTCCAATACCTTTGCACTTTT
TGCATTCCTTGGAGCGTGACCAGAACCCCGTTAGAGAAAA
TTATAATTTAAAAAGCAAGGCAGATTGGCCTTTGCTGTCC
AAGGTGAAAAGTCAATATTACAATTTGTAGAGCGATAAAG
CTGAAAAACGAGCGTGAAAAATCAGTTTCAACGCTGTGAC
AATAGACTGAAAGGACAAGACAAAGATCTGGCCTTATGCA
TTATGTATTTTGACCCGAAGAAACCCTCATCTGTCCAACT
GATCCGTACAGTTAACCAGCTCTCATGACGGCTTTCCCAC
CACTTTTCTTTTTTTTATTTATTCAACCTGTTGCTTCTTT
ATGCTATTGTATTTTTATTGTATATAAAGAGATTTATTCT
ATTATGTATTTACCTCAGAATATAAATCTGGTGCAAACAT
GTTTGTACGAATAAATATACGTTTTCTACTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
neurog1-001 Contained in:
OTHER neurog1-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026417 (1)
  • Ensembl_Trans:ENSDART00000078563 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC056575 (1) 1414bp
    GenBank:BC066427 (1) 1407bp
    GenBank:CK147963 (1) 843bp
    CITATIONS (2)