Transcript

neurog1-201

ID
ZDB-TSCRIPT-090929-9092
Name
neurog1-201
Previous Names
  • neurog1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026417 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026417|OTTDARG00000020942|ZDB-GENE-990415-174 neurog1|OTTDARP00000021674 neurog1-001 LG_ BX571940.12 Danio rerio protein_coding KNOWN, 1393 bp
CTCACACGAGCTGATTGAGGGTTAAGAGCAAGACAGACGC
GTGCCATTATCTTCAACACAAACTATCTGCAGGATTCTGC
AAAACCTCAAGCATCTCCCAGCCCACCAATAAGGTTATCA
ACAATGGAGATCGTATACTCCGATATGGAAACCTCAAGCT
GTGACTACTCCTTTTCGCACACGGATGATGAGGACTCGCG
CAGCAGCCTCCACCCCGCGTCCCCCGCGTCCTCCTGCGGA
AAACCACCTGCGTCTCCAGCCGGGCTCCAGCAGAAGAAAA
GGCGCAGGGGGCGCGCGAGGAACGAAACCACTGTGCACGT
CGTGAAGAAGAACCGCAGGCTGAAGGCCAACGACCGCGAG
AGGAACAGGATGCACAACCTTAACGACGCATTGGATGCTT
TGAGAAGCGTCCTGCCTGCGTTTCCTGACGACACAAAGCT
GACCAAAATTGAGACTCTGCGCTTCGCTCACAACTACATC
TGGGCACTTTCGGAGACCATCCGGATCGCAGACCAGAAGC
AGGGCAAGTCAAGAGACGGTCCGCTGCTGCTCCCCGGACT
AAGCTGCATGGCAGATGCACCCAGCCCCGGCAGTGACTCT
TGCTCCTGGCCGTCGGGGGCATCCTCGTCGTCTTCATCAC
CGTCTTACTGCAACTCAGACCCGGGCAGCCCCGCAGCCAT
GGACGATTTTGGATACTTGCAAACCGACGTAGTGTACAGC
TACCGCAACTTCGTGCCTAGCATCTATTAATGTGACTTTA
AGCGTTCTCATGTCGGTATAGAATCTCCAGAAGTATGTAG
TAGTGTAAGACCACTGTTACTTTTCTATTAGAACCAAGAG
CACAACGTTAGGTATTCACTGTTTGCCTTAATGACAGTCT
GCAAATGAGAATGTTTTATTTTTGTACGTTTTGATATTGA
TGTTGATGTTGATGCTTTTTTCCAATACCTTTGCACTTTT
TGCATTCCTTGGAGCGTGACCAGAACCCCGTTAGAGAAAA
TTATAATTTAAAAAGCAAGGCAGATTGGCCTTTGCTGTCC
AAGGTGAAAAGTCAATATTACAATTTGTAGAGCGATAAAG
CTGAAAAACGAGCGTGAAAAATCAGTTTCAACGCTGTGAC
AATAGACTGAAAGGACAAGACAAAGATCTGGCCTTATGCA
TTATGTATTTTGACCCGAAGAAACCCTCATCTGTCCAACT
GATCCGTACAGTTAACCAGCTCTCATGACGGCTTTCCCAC
CACTTTTCTTTTTTTTATTTATTCAACCTGTTGCTTCTTT
ATGCTATTGTATTTTTATTGTATATAAAGAGATTTATTCT
ATTATGTATTTACCTCAGAATATAAATCTGGTGCAAACAT
GTTTGTACGAATAAATATACGTTTTCTACTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations