Transcript

polr2gl-002

ID
ZDB-TSCRIPT-090929-9091
Name
polr2gl-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026416 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026416|OTTDARG00000020941|ZDB-GENE-030131-2808 polr2gl|no_translation polr2gl-002 LG_ BX571940.12 Danio rerio protein_coding KNOWN, 569 bp
CGCGTGCTCGCGCTGTCGAGATTCGGCGCCTGAACGCACT
GACATAGAAAGTCGTGGCTGTAGAGTTTTAATTCAAGACT
TTTGGAAGCTAAAATACAATAAGAGATGTTTTACCACGTA
AGTCAGTGGGTGTTTTAGTTTTACGTGATAAGTGAGTTGC
AGCACTTATAAATGTCCGTCAATGTTTTCTGTGCTCACTG
TTGTTTACACGTTGTTTGTCACAATAGATCTCTCTGGAGC
ATGAAATTCTCCTCCATCCAAGATATTTTGGACCCAACCT
TTTGAACACAGTCAAACAGAAACTGTTCACTGAGGTTGAA
GGAACATGTACTGGAAAGTATGGCTTTGTTATTGCAGTAA
CCACAATCGATAATATTGGAGCAGGGGTTATACAGCCGGG
CAGAGGTTTTGTGTTGTATCCCGTCAAATACAAAGCCATC
GTCTTCCGTCCCTTCAAAGGAGAAGTTGTGGATGCTGTTG
TCACTCAGGTTAACAAAGTTGGACTCTTTACAGAAATTGG
CCCCATGTCTTGTTTCATTTCTCGACATTCTATTCCCTCT
GAGATGGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations