Transcript

polr2gl-201

ID
ZDB-TSCRIPT-090929-9090
Name
polr2gl-201
Previous Names
  • polr2gl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026415 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026415|OTTDARG00000020941|ZDB-GENE-030131-2808 polr2gl|OTTDARP00000021673 polr2gl-001 LG_ BX571940.12 Danio rerio protein_coding KNOWN, 1477 bp
GCAGTCGTTTTCACCCGGAAACATTCGCGTGCTCGCGCTG
TCGAGATTCGGCGCCTGAACGCACTGACATAGAAAGTCGT
GGCTGTAGAGTTTTAATTCAAGACTTTTGGAAGCTAAAAT
ACAATAAGAGATGTTTTACCACATCTCTCTGGAGCATGAA
ATTCTCCTCCATCCAAGATATTTTGGACCCAACCTTTTGA
ACACAGTCAAACAGAAACTGTTCACTGAGGTTGAAGGAAC
ATGTACTGGAAAGTATGGCTTTGTTATTGCAGTAACCACA
ATCGATAATATTGGAGCAGGGGTTATACAGCCGGGCAGAG
GTTTTGTGTTGTATCCCGTCAAATACAAAGCCATCGTCTT
CCGTCCCTTCAAAGGAGAAGTTGTGGATGCTGTTGTCACT
CAGGTTAACAAAGTTGGACTCTTTACAGAAATTGGCCCCA
TGTCTTGTTTCATTTCTCGACATTCTATTCCCTCTGAGAT
GGAGTTTGATCCAAACTCAAATCCTCCATGCTACAAGACA
GTGGATGAGGACGTTGTGATTCAACAAGATGATGAAATTC
GACTGAAGATTGTGGGAACTCGTGTGGACAAGAATGATAT
TTTTGCCATTGGATCTTTAATGGATGACTACCTGGGTCTT
GTGAGCTGATTCCTCTGCCGTGAATATGGGAAATTTGAGA
GTTGTTGCTGTGGTGGTGATGATACTTAGTTTGTGTATAT
ACTGTAATTATTTCCCTATTCATTTAGATTAGTTTTTCTT
TTTTTCCATTTTCTGTTTTTATTGTCTCCTTTTATTAAAA
TGTTGGTAGTACAGTTTCAAGTTCAAATTTGAAACCAGAT
GAAGTCGAATGGGAACAAAGAGTAGCTCAGCAGTGGCTCT
ACATCACGTGTCGAACTCTGTTTCTGGAGGGCCGCAGCTC
TGCACAGTGTGGTTCCAATTCTGATTAAACACACCTGATC
CAACTAATTGAGTCCTTCAGGTAAATGTGTTGAAGCAGGG
TTGGAACTAAACTGCAGTGCTGCGGTCCTCCAGTAACTGA
ATTTGACACCCCTGCTCTACATGATGGAAAATCCAGGGGT
GTCCAAACTTAGTCCTGGAGGACAGGTGTCACTGCAACTT
CCTCCAACTAACTGGCCTGGATGTCTAATATACCTAGAGC
ATACTTGGCTGGTTCATATGCATTTAAATGGGGTATGAAC
CAAAATATGGAGTACACTGTACCTCCAGGACCGAGTTTGG
ACACTCCTGACTTATTCTACAGCGAGGCAACAGAGAACAT
GGTATAATAAATATGCCTGTTGAAAAATGTTGAGCAGATT
GACATGTATGTTTTGTAAGGACTGTAATTATTCATTACAT
TGTTTTTAGAGTTTTACAGTCTCCTTATATAAAGAGAATT
TTTATATTTTTTTTTTGTAAATTCCTGTCTGTACCTATGT
ACTGCTCATTTGTAATACAGTACTCACAAAATTTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations