Transcript

ctbp1-201

ID
ZDB-TSCRIPT-090929-9087
Name
ctbp1-201
Previous Names
  • ctbp1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026412 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026412|OTTDARG00000020939|ZDB-GENE-010130-1 ctbp1|OTTDARP00000021670 ctbp1-001 LG_ BX324205.5 Danio rerio protein_coding KNOWN, 4952 bp
CTCGACTTCCTTTTCTGTGCAGATTTCATGGCGAGTGATA
GCGGAGAAGAGTTGATTCACCTACCGTGACCACACTGACC
CGCACATCAACCTCCAGAGACGCCTTTTTGTCGGCTGCCA
TTGTAAAGACTGTGACGTCAGCAGAGTGGTTGATTGGCTT
TGACATCATCAAATATTTTAAGGATTTTGGTGGTTTCTTG
ACTGAACAGTCTTGTCGCGTTGTGGACGTAGCTGGTCTTA
TCAAAGAACTGCCAGTCGATGGCTCTGATGGACAAACACA
AAGTGAAGCGGCAGAGATTGGACCGCATCTGTGAAGGCAT
TCGACCACCCATCCTCAATGGCCCAATGCACCCTCGTCCT
CTGGTGGCGCTGCTGGATGGACGGGACTGTACAGTGGAGA
TGCCCATCCTGAAGGACGTGGCCACTGTGGCTTTCTGCGA
TGCCCAGTCCACCCAGGAGATCCATGAGAAGGTCTTAAAT
GAGGCTGTTGCTGCTCTGCTCTACCACACCATTACACTGT
CACGAGATGACCTGGACAAATTCAAAGGCCTCAGGGTCAT
TGTGAGGATCGGTAGTGGGTTCGACAACGTTGATATTAAA
GCAGCAGCAGAGCTTGGTATTGCAGTGTGTAATGTGCCAG
CTGCATCTGTGGAGGAGACGGCAGACACTGCCATGTGTCT
AATTCTGAATCTGTACCGCCGCGTCACTTGGATGCATCAG
GCACTGCGTGAAGGCACCCGAGCCTCCAGCGTGGAGCAGA
TCCGGGAAGTAGCCGGAGGCGCAGCACGTATTCGAGGAGA
AACGCTGGGCATCATTGGGCTGGGACGTGTGGGGCAGGCA
GTGGCTCTAAGGGCGAAAGCCTTTGGATTTGGAGTGATTT
TCTACGACCCGTACCTGCCTGATGGAGTGGAGCGATCACT
AGGGCTCCAGCGCATGGCGACACTACAGGACCTGCTTATG
CACTCGGACTGTGTCTCGCTACACTGCAGCCTAAATGAAC
ACAACCACCACCTCATCAATGACTTCACCATCAAACAGAT
GCGTCAAGGCGCCTTCCTTGTGAACACTGCGCGTGGTGGT
CTTGTGGATGAGAAAGCTCTGGCTCAGGCTCTGAAAGAGG
GCAGAATACGAGGAGCAGCACTGGACGTCCACGAGACAGA
GCCCTTCAGTTTCTCTCAGGGCCCACTGAAGGATGCCCCT
AATCTTATCTGTACCCCACACACATCCTGGTACAGTGAAC
AGGCCTCCATTGAGGCCCGAGAGGAGGCAGCGCGGGAGGT
GCGCAGAGCCATCACAGGTCGTATCCCAGACAGTCTGAAG
AACTGTGTGAATAAGGAGTATTTGATGGCAGCCTCTCAGT
GGCCGTCTATGGAGGCCACCACTGTGCACTCTGAACTCAA
TGGAGCTGCAGCCTATAGGTTTCCTGCAGGGCTGATTGGC
GTAGCAGCGGGTGGGCTGCCCGGAGCCGGGGCAGGAGTGG
AGGGCATTGTGGCTGGATCTCTACCACTGGCCCACGCCAT
CGCCCCGGTCTCGCACCCACCTCATACCCCTTCCCCCGGG
CAACCCTCCAAGGCTGAGGCAGACAGAGACATCCCTTCCG
ACCAATAGCATCCCAGCACATTCCATCTTCGCCCTGATCG
GTGCCCTTTCAGTGGGACTTACACCCCTGCTTTTGATGTG
ACCTTGGGTCACCCCAGTCCAACAGAACACGTGTACAACC
CAGGAGTGAAACCCTCTACCCCAAACATACCCTCATTTCC
ACTCGCTGTATTCTCTGTTGTTCACTTTGGCAGAAAGCAA
TAACTTCTCTCAAGGATTCAATAATTGGGTTGATACACAC
TATTTCTAAGCTTCGAAATCCCAGTTCCTTTGCTTTGTAT
CTACTCTGGACTAGTAGGAGTTTGTTTTCCGAGTAGTTTC
TTACATTTCTGTTCTATTCTTATCTGTTTTAACAGCGTGG
AAATAAACGCATGGACCTTGTTTTCTTTCCTTCATCCCCT
GCCCATCCTCCACTTAGCATACATTTGTAAACCTTCTTAA
CTCGTCCCATCTCAGCAAACGTTTGATGGTCAAAACAGAG
TAACAGCTGGCTCACACCGTTAAATTCAACAGCCATCAGT
GTTTGTTTCCCAGCTGGTGTTCAATAACGGAGATCAAGGC
TAATGGTGATGGCCTGTGGCTGAGAGTAACTCGGCCCACG
GGAAGAGCTCAGATGTTTTGCGTTCCTCTCACTCTCTCTT
CATGTGGAAGGCATCTTTTAGAAATGCCCATCCTTTTGTC
TCTTCGCAGAAAACAAGAGATTGAGCTTCACCTCCAGAGC
TGTTGGGGATTTCATCGTGTGCTCCACTTTAGGGTTTACA
GCGTCTGCATAACCGTGTCATTGAAATCCCATTGTCCCTC
TTTGTGAACAGCTTGATAACGCTGGGAGTCAACTTCATAC
AGTTTCAAATAAAGCCATATTCGTTTGACAAAGTGTATAG
CATAAGATATATCTGCGAGATTTGAGACACCTTTAAACTC
CCTACAAACGAAACAAAACAGGAGATGGTCTTATTACAAC
ATTGACCTCCGCTTGACTCGTACTGAGATCCACCATAGCT
AAGCTGAAAATATTGGCACCTTTTTTTTATTTTTTATTCT
TAGCCATTTGAAGAATATTTGCCTTGTTTTCCATATCTTC
TCTTTGTCCTGGATTATATCTTGCTGTACTTCCTCCTTGT
GCCTCCTTTTTCCGATTAGGCCTTCTCTTTGTGACGTAGC
GAGGCATGTCCACCCTTCATATCTCCGCTCGTGTCTTCAG
CTCTCATGAAATCACTGTGTAGCCCATCCGCCCGGCCCTT
CCTACTTCCAACAAGGCACTTAAACTCTTAACACGATTTC
TTAAACTCACAAACACATTTTCGTACAAACCTGATATATA
CCTTTTCATCCACCTTCTCTGGGAGGTTTATGGAGGTTGT
AGTACTGTTGATGACCAGCAGGTGGCGATGACTTGCTTTC
CCCCCCTCAGGTTCACAGATAATTCATCCTCGCTCAGCTG
ATGCTTGCACAGTAAAAGTTTAGCAGACCTGTCGTGGGCC
CTTCCATCCATCGCTCATTGTCTGTCTCACACTTCCAGAA
AACTCAGGATGGGCCACACCGAATTAAAAGCTGCTCATAC
TTAGAGCTTGACATTTGCATGGGCATCGATAATATCAGCC
CTCTCCACGTATACACCATTTAGAGCACAGAAGATAAGGT
GGAAAGAATGTAAAAGCTAGGTCATTGAAACGCTGGTTGC
TTTCCAAAGAAGGTAGGAGAGTGTCTCGATTAGCGTTCTG
TCTGAAGAGAAAGGCCTTTCTAGTACCTCAGTAACAGATA
TTGAATGTAAGCTCAAATCTTTCTCGCTTTGTACAGCTTC
TTTTTTTGTTGTTTTTAGCTCATGAGAGGGTGTGTATGAG
TCTGCATGTTTGCGAAAGTGTGTGACTGCTTATCCAGAAC
ATCAGTTTTTCATTCACAGATGTTAAAATAAAGCTTTGTT
TCTTTTTCTCCATGCATAGGATGTCTATATTGGTTCGTTA
GATGTAGTTTGAATCTCAGGCTTTAGCTCTAGATAGTTCT
CGATCTGTGATTTTTGTATTTTTCTGTATAAAGGAGCACA
GTTTCATGTCTCGGACAAGATGTATGCTAATAAATGAAAC
AAAAGGGGGTCTGAAGCTGTTTGTAAATGAGTGTGAATGG
GGATTCATTGCTGTGTACGAACGGCCCGTTCTAGATAGTT
GTCGTATATGTTCCCATAAGGTCATCGCCCTCAATCGTTA
GTTCTGATGGATTAATGCATGTTTTCAGGCCCCGCCCCCC
TCGCTTTTTCCATCGGCCACACTTTGACGTCGAGTTTTGA
GTGACGTGCAGCTTTTCCTTGACTGCAGTGATGCCCTTTA
TTCGTAACACTTTATAGCTGCTCTGTAAAAAGGTCCCTGT
ACTACAGCATTTTTGAATTTCTTCTAGCATTATCGTGGTG
TTTCTTTGCCGTCATCAAGCTTTGATATGAGAAGTGCACT
ATGTGTTACAACCAAGAAATGAGACCCTTTTTGATCTAGT
TTGTGTCATTCAGTGTTCGACATGTTGTATTGAAACATTT
CAAGATGAGTCTCATTCCATTTTTCACCCTCGGCGTCCCG
TGGTCTCCTCGCTGCCTTAATGTCGTAGGCTTGGTGATTC
TCGTTCTTTCCCCCGGCAAACACGCATGTAAGAGAGAGGA
AGCTGTTTTCTTTAGCCGTATGTTGCTCTGATGCTTATTT
CCGCAGAACACACATGGCTTTCACTTTGAGGTGTGAAATG
CTCGGGCACTATGAAAGACCCTTTCAGAAGCTGCCCATGT
GGTAGTCCATGAAGGGAAGCTGAAGAGGACAGATATGGAC
TGATATGGAGCAGTCAGTTTCTCTCTCAGGGTTCAGATAC
ACAACATATCCTTCAGCCGCCAGCTACACACTTTTCCTCC
ATCCGAAAGAAAATCACGGTGTAGATCTCCAGAGCTCTCT
TACACAGTTCATCTTTTAACAGTGAGTGTCTTTCTCTGTG
ATGCTTTCCTTACTATCTCTCTCTCTCTCTCTATCTCTCT
CTCTCTCTTCTGCTCCTTTTTTTTGCGTATTTGTCGCACT
GACACCTAACAACACAAGAATGAATGTTTTAATAGAACTG
CGTGTAACGTTGAAGTTGGGAAATGTATTTTTACAACATG
TGAACTTTTTATTCCTTTCTCTTACCTTTTTGTTGTGAAT
TGATTTCCCCCCCTCCATCACCAGACTGCAAAAAAAAAAG
TTTTAAAAAATGACAAAAAAAATCCTGTAACTAGGCTCTT
AAGCTTTACTTTTGTTTTTGTTTACTTTTTTATTAGAAAA
CAATCATGTTTGTGATGGTAACCTCTGATGGTAAATTCCA
CAAGGTATTTTAATAAAATCCTAAAGATTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations