header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9059
Transcript Name: bcs1l-202
Previous Name: bcs1l-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026382 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026382|OTTDARG00000020920|ZDB-GENE-040426-938 bcs1l|OTTDARP00000021649 bcs1l-002 LG_ BX001051.29 Danio rerio protein_coding KNOWN, 795 bp
ATTCAATCATTCTGCAATGATAGAGAACGCTTGCTTTCAT
GCACTTATATTTGATTGGCTTCTTTTTCCTTTGTTTTAAG
CTAACAGGAGAAAAAGGTTGTTTGTAAATACGTGACCTTA
TTTACACTATCGATTTGGACTAGTTGGTGTTGGCACGGCA
CTTGCAGTTGCCAGAAAAGGAGCACAGGTTGGCATGATTT
TCTTTCGGAGGCATTACATGATCACTCTGGAGGTTCCAAG
CAAAGATAAAAGTTACCACTGGCTCTTAAGCTGGATCACC
AAACATGCCAAACACACACAGCATCTGAGTGTAGAGACCT
CATACATGCAGCACGAGAGTGGGAAAGTCCACACACAGTT
TGACTTCCACCCAAGCCCAGGCAACCACATCATATGGTAT
GGAAGGAAGTGGATCAGAGTGGAGCGGGTCAGGGAGAAGC
AGATGATGGACCTGCACACTGGAACGCCCTGGGAGTCTGT
CACCTTTACTGCTTTGGGAAGAGACCGCCAGACATTCTTC
AACATACTTCAGGAAGCACGTGAACTTGCTTTAAAGCAGG
AAGAGGGCCGGACAGTGATGTACACTGCAATGGGAGCGGA
GTGGAGACCCTTTGGTTTTCCAAGGAGAAGACGGCCGCTG
TCTTCAGTAGTGCTGGAGAGTGGAGTGGCGGAGAGGATTG
TGGATGATGTAAAGGAGTTCATAGGCAATCCTAAGTGGTA
CACTGACAGAGGCATTCCATACAGGAGGGGATATTTGCTG
TATGGCCCACCTGGCTGTGGAAAGAGCAGCTTTAT

bcs1l TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA bcs1l-201 (1) 1694
bcs1l-202 795
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bcs1l-202 Contained in:
[BAC] DKEYP-68F9 (1)

OTHER bcs1l-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026382 (1)
  • Ensembl_Trans:ENSDART00000145892 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN172319 (1) 823bp
    GenBank:CN018182 (1) 764bp
    CITATIONS (2)