header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-903
Transcript Name: jdp2b-201
Previous Names: jdp2-001, jdp2b-001, zgc:92851-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000007035 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000007035|OTTDARG00000006381|ZDB-GENE-040718-197 jdp2b|OTTDARP00000006259 jdp2-001 LG_ AL929435.16 Danio rerio protein_coding KNOWN, 1100 bp
CTGCCGTCACTCGGTGGAGAGTTCCGCATTCCAGCGCGCT
CGGAGGTACATAAACGCGCTGATGCAACGGGAACAAACGC
ACAACCAAGCTGAACGGACGAGCAGCCGCAAACTCTCAGC
ACAAAACAACAATGATGCCTGGTCAAATCCCTGATCCGCT
GGTCACAGCTGGTTCTCTGCCCAGCGTCGGTCCTCTGGCC
GGTTTTCCCGCCACCACACTGACGGAGCAACTCAAACTGG
CGGAACTTTACCGTCTCGGGACGGTTCTTTCTCCGTTAAT
GCTCAACCGACACGCCAAAAGACCGTTTGACGCCATTAAG
AGTGAGGATGATGACGATGATGAGCGCAAGAAAAGACGGC
GAGAGAAGAATAAAGTTGCAGCTGCTCGCTGTCGAAACAG
AAAGAAGGAAAGGACAGACTTTCTGCAAAAGGAGTCCGAG
CGGCTGGAGATGTTGAACTCGGATCTGAAGTCTCAGATTG
AGGAGCTGAAGTCGGAGCGGCAGCAGCTGATCGTGATGCT
GAACCTCCACCGGCCCACATGCATCGTCCGCACTGACAGC
GTGAAGAGCGACGAACACCCGCTGGAGCCCCGCGAAGACT
GAATCACTACCGGGGATTTCTGCTAAAACTTTCTTGCTAG
ATTCTCAATGAAGAAGAAGGAAACGGATTTGTGTGTCTAC
CAAAAGATCGTCCCTGAAATCGGCCGTTAAGCTGGTGGTA
AAACCTTCTTGCCAGATTCTCAACGAAGAAGTTGAAAACG
GATTTGTGTCGACACCAAAACCTCGTCGCTGAAATCGGCA
GTTAAGCTGGCGGCGACGGAGCATGTTTATGCAGTGTTTT
TGGCTTGTGGAGATAAATAAAGCGTGTTGTTCCACGAGCG
GCCGCCAGATGTCGCTGTCGGTCTGAGAAACTGTTCACTG
ACGTTTACATTAGTTGGCGTTGATTGACGCAGTCAGTTGT
GTATTTGTATTATACGTTGTGTTTACTATATGACTGTTTT
TTTATTACGCCATCACATGATGGGGTGACTTATATTCCTA
ATGTGTCTGTTGAGCGGCCACTTTTGTTACAAAGAAATAA
AGCCTATTTTTCAAATAAAA

jdp2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA jdp2b-201 1100
ncRNA jdp2b-002 (1)    Ensembl 549
jdp2b-003 (1)    Ensembl 790
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jdp2b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000007035 (1),  Ensembl_Trans:ENSDART00000014166 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK398708 (1) 885 bp
GenBank:CK362944 (1) 834 bp
GenBank:CF550185 (1) 789 bp
GenBank:CT702759 (1) 789 bp
GenBank:CK360068 (1) 753 bp
GenBank:BQ092022 (1) 613 bp
GenBank:BE201200 (1) 539 bp
GenBank:BE200559 (1) 533 bp
CITATIONS (2)