header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-191
Transcript Name: jdp2b-003
Previous Name: jdp2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058757 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058757|OTTDARG00000006381|ZDB-GENE-040718-197 jdp2b|no_translation jdp2-003 LG_ AL929435.16 Danio rerio protein_coding KNOWN, 790 bp
CGAGCAGCCGCAAACTCTCAGCACAAAACAACAGCAATGA
TGCCTGGTCAAATCCCTGATCCGCTGGTCACAGCTGGTTC
TCTGCCCAGCGTCGGTCCTCTGGCCGGTTTTCCCGCCACC
ACACTGACGGAGCAACTCAAACTGGCGGAACTTTACCGTC
TCGGGACGGTTCTTTCTCCGTTAATGCTCAACCGACACGC
CAAAAGACCGTTTGACGCCATTAAGAGTGAGGTGAGACCC
GACATCACATTTAACCAGTATTAAAGTCAGTTTCTGAAGG
CGATGTGGTTGTAAATGTTGCATATTGTAAAAACGCCAAC
GGTTTATTAAGTTACACAACAGACATGAGACAGTTTGAAA
GAAGTGAAACTGTTGCTTAGTGTATTGTTTATCTGCTGGT
GTAGAGCGACATCTGCTGGACTCCACCGTTATGCTCATGA
GTTTTTATTAGAATATATTGGTTGAGTTGATACTTATTGT
TGTATTGTTTATGTCTATTTTATCAGTGTTAAATAATTAA
AGATTTGAAAACCATGTAGATAATTTCATTATTTATCAGG
TTATAAATGCCAGGTAAGCAGCATAGCAAATCAAGGCAAA
AACGAGTGTAACTGTCATAAATGAGATTGTTTTGTTTTTA
CTGTAATTATAAGTTAATTATAAAACGTAAAAAAGTACTG
TATTATTTAATGTAAAGCAATATTTTCTAGTTATTCTAAA
ATTTTATTTAATAAATTAAGAATTTACCCCTGGTAATTGT
TTACCCTCAGTTCAATAGCCTCAATCAAGT

jdp2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA jdp2b-201 (1)    Ensembl 1100
ncRNA jdp2b-002 (1)    Ensembl 549
jdp2b-003 790
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jdp2b-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058757 (1),  Ensembl_Trans:ENSDART00000153231 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT674420 (1) 792 bp
CITATIONS (2)