Community Action Needed: Please respond to the NIH RFI
Transcript

flt4-201

ID
ZDB-TSCRIPT-090929-9020
Name
flt4-201
Previous Names
  • flt4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026343 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026343|OTTDARG00000020901|ZDB-GENE-980526-326 flt4|OTTDARP00000021622 flt4-001 LG_none CR381700.6,CR627495.19 Danio rerio protein_coding KNOWN, 4439 bp
TCTGTTGGCTTTATTAAATGACATCAGAAAACGCGCAGGT
TTGCTAGAATATCTAAAACCCCGGAGGACTGGAAACCTGG
AAATGAAGAGAGATTTTACGTTTTTCTGTCGGATTTGGAT
TGGGATTCCCTTCTTCTCAGGTCTGGTGAATGGGTTTTCT
ATGAGTCCACCCACCCTTGACAACACCAAAGACCAGCTTG
TGATTAACGCTAACGACACACTGAACATTACATGCAGGGG
TCAGCGAATTCTGGACTGGAGCTGGCCTGAAGAGTCTTTG
AGTAAAGTGGAGTTTACTGATCGCCAGGGTCAGCAGTCAC
CCACTGACACCCCAGGGTATAGAGAAATCAGGCTGAAGGA
GTGTCAAGGGGTGGCTGGAAAACCCTACTGCAAGATCTTA
ATACTTACCAATGCCCAGGCCAATGACTCGGGTTATTACC
GCTGCTTCTACAAGGACATTAAAGCTGTTATTGATGGCAC
CACGGCAGCCAGCATTTTTGTGTTTGTTCGAGACCCAGAG
CATCCATTCATCAAAAGGGGAGACAACGACATGGAGACCA
TCTTCATAACAGACTCTGAAACACACATCGAAGTACCATG
TCTGGTTTCAGATCCTGACCTAAAAGTCACTCTCTTCTCG
TTAGTGCCGTATCCAGAGCCTGTGGATGGCAGTGTGGTCA
CCTGGAATAATAAAAAGGGTTGGTCGATTCCCAGGCATAT
CATTCAGAACACTTCCACCTTTATTGGCTTCTACTGCTCC
ATCTCAGTCCAAAACAGCCAGCACACATCATCAATCTATG
TTGTCCAGGTCATTGGGCTGAAGTTTTATGAGTTCAAGCT
GTTTCCTGAAGACTCGCCTGTGGAGTTGATGCAGGGGGAG
AGTTTGGTGCTCAACTGCACTGCACTGGTCGACTTCAACA
CTGGTGTGGATTTCCAGTGGGACTATCCAGGCAAAAAGGA
GAACCGGTTGGCGAGTTTACAGCCTCTGCGTAACGTCCTG
GATGAAGCCACGGAAATCTCCAGTATCCTCTCAATCAGAA
ACATTCACTTGGATGATAGTGGCTACTACACCTGCTGGGC
TAATACTCTGGAAATGAAACGAGAGCTCACTACTGTAGTC
ATAGTTCATGAAAAACCTTTTATCAGCTTGGACTACAGGA
ATGGATCAGTTATAGAGGCAAAAGAGGGACAAAAATCTGT
CCGGCTATCCGTAAAAGTGTCAGCATACCCTTCACCAGAA
ATACAATGGTATAAGAATGGAAAACTGATCAGCAGCAAGA
ATTCAAGCAGGTTTAAGGTCCAGCAGCACTCTCTACAGAT
CAGGGATGTGTGTAAGCAGGATGCTGGAGAATACATGCTG
GTCCTGAAAAATAGCCCTGCAGCCCTGGAGAAAAGACTCA
ACTTTACTCTCATAGTCAACGTTCCACCTCAGATTCATGA
GAAGGAGGCAGCACCACCTACAAACCTCTATGGGAAGGGC
ACTCGACAGATCCTCACTTGCACCGCAGACGGGAGCCCTC
CAGCCTCCATCAGCTGGCAGTGGAGGCCCTGGAGCCCCTG
CGATCTGGAGCGTACCCGCAGAGCCCTGAGACGGAGGGGT
GGACGAGACCAGAGTCCTTTCTGTCACAACTGGATGGATT
TGGACCCTGAACATGCTGTAAACCCTATTGAGAGTATTGA
CACATTGACTCAGATGGTGGACGGCAAAGAAAAGACTGTC
GGCCGTGTGGTTATTCAGAATGCCAGTGTGCCAGCTATGT
ACAAGTGCTTGGCTGAGAACAAAGTGGGAAAAGATGAACG
ACTGATTTATTTCTACGTAACCACTATCCCTGAAGGATTC
GATATAGAGATGGAGCCCTCAGAGGATCCGCTTGAGCAGG
ACCTGGTACAGCTGAAGTGTAATGCAGATAATTTCACCTA
TGAGAACCTGCGGTGGTACCGCCTGGACCCGCAGACTGTT
CCTCCAGAGCTGGACTGCAAGAGTCTGCACCAGTATGCCA
CATTTTTGGAGGGACAACTATCTTTTCAGACCACCAGCAA
CAACTGGGTCCTGCAGCTTAACATTACCAACATTCAGCTA
CAGGATGAGGGGAACTATGTGTGTGAGGTGCAGAACCGAC
GAACCGGGGTGAAACATTGTCACCGCAAATACATCCCAGT
CAAAGCAATGGAAGCACCTCGATACCGTCACAACCCAACT
AATCATACGGTAAATGTGAGCGAGTCGCTGCAGATGAACT
GTGATGTGGAAGGCACACCCTTTCCTCAGCTGTCCTGGTT
TAAAGATAACCAACCCCTCCATCAGATATCAGGGATCCTC
CTTCAGGACTCCAATCGGACTCTCAGCATTCAGCGAGTGC
GAGAGGAAGACGCCGGTCTGTACACCTGCTCTGCCTGCAA
CCAGAAGGGCTGCGTTCAGTCCTCCGCCACGGTGTCAGTG
ATTGGCTCTGATGACAAAACCAATGTAGAAATAGTGATCC
TCATCGGCACAGGAGTCATCGCCATCTTTTTCTGGGTCCT
TCTTCTTGTCATCTTCTGCAATGTCAAGCGAGTGAACCCA
GCTGATATCAAGACAGGCTATCTGTCCATCATCATGGACC
CGGGGGAAGTGCCGCTGGAGGAGCAGTGTGAATACCTGCC
GTACGACTCCAGCCAGTGGGAGATTTCCAGAGACAGACTG
CGCCTCGGTAAGGTGCTCGGCCATGGAGCTTTCGGGAAGG
TGATTGAAGCCTCAATCTTTGGTCATGACAAGAAATCCTC
TGCAAACACAGTGGCTGTCAAGATGTTGAAAGAGGGAGCA
ACAGCCAGCGAGCACAAAGCCCTGATGTCAGAGCTGAAGA
TCCTCATTCATATTGGAAACCATCTCAATGTTGTCAACCT
TCTTGGAGCTTGTACCAAACCTAACGGTCCTCTCATGGTT
ATAGTGGAGTATTGTAAATATGGAAATCTGTCCAACTTCC
TGCGTGCCAAGAGGGAGTTTTTTTTACCATACAGGGATCG
TTCTCCTAAAACCCAAAGTCAAGTGCGACGGATGATAGAA
GCAGGTCAGGCGAGCCAGAGTGAGCATCAGCCGTCCACTT
CCTCCACCAACCCTCCACGTGTTACAGTGGATGATCTCTG
GAAAACTCCACTCACAATAGAGGATCTGATATGCTACAGT
TTTCAAGTTGCACGAGGAATGGAGTTTCTGGCATCTCGTA
AGTGTATTCATCGAGATCTGGCAGCCCGAAACATCCTCCT
GTCCGAGAACAATGTGGTGAAGATCTGTGACTTTGGTTTA
GCACGGGACATCTACAAAGACCCTGACTATGTGCGCAAAG
GCAATGCCAGGCTGCCGCTGAAGTGGATGGCTCCAGAGAG
CATCTTTGATAAGGTTTACACCAGTCAGAGTGACGTCTGG
TCTTTTGGAGTTCTGCTCTGGGAGATTTTCTCACTAGGAG
CGTCTCCATACCCCGGCATCCAGATTGATGAAGATTTCTG
CAAACGACTCAAAGACGGTACCAGGATGAGAGCACCAGAC
AATGCGTCCCCTGAAATATATGGCATCATGTTGGCCTGCT
GGCAGGGCGAGCCCAGGGAGAGACCCACATTTCCAGCTCT
GGTGGAGATACTTGGAGATCTACTGCAGGAAAACAGTCTA
CCAGAAATCCCGTTCAATGTGTCTCAGAGCTCAGAGGACG
ATGGCTTCTCACAAGCTTCTTCCAGACCACCATCACAAGA
GGAGATCAGATTGGCCTGCAACACACTGCCAACACGATAT
TACAACTGCGTGCCGTTTGCTGGCTGTGTGATGGTCGGGC
CCTCCAGCACATGTCATTCTCGAGTGAAGACCTTTGAGGA
ACTTCCTATGGAAATGACATCACACAAGACACAGCATGAC
AGTCAGACAGACAGTGGGATGGTTTTGGCATCAGATGAAC
TGGAGAGGTTTGAACACAAGCACAGAGGAGCCATGTTGAC
ACATGCGACGACGGGCCAAAGCACTGAGCGCCTCATCAGT
TGTCCATCGGTGAGCAGCAGCGGCAGCGGTGGTGGTTTGC
TCCGTCCAGTGTTCTTCACTCAACTCTCAGGCCAGACCTT
CTACAACAACGAGTACGGTCATCTGTCAGAGGAGGGCGTC
AGCGACTACTTCTCCTCCTCAGACCAGGCCGTTTATAAGG
AAACCTGCCCGGCAACCTCCAACCTGTAACAAGACTGATT
GGCCAGTCATATCCCAGTCCTGACCCCCCTCTCCCACTCA
CACTTACTGAACTGACTGTAGCTTTGTAAAATTCTCTCAG
CAGCCACTGGGTGGCACCATTACATCAATTTCAAAACCAA
TAAAGTATTTTATCACTTTAGTTCCATATATCTTTATATA
AAGAGTAAACAGCTTTTATTTGTACAAAATAATGAGAAAT
GAAGCAGAATGGAGAAAAAAAATAAAGGAATATATCTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations