Transcript

nifk-202

ID
ZDB-TSCRIPT-090929-9003
Name
nifk-202
Previous Names
  • nifk-003
  • mki67ip-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026322 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026322|OTTDARG00000020890|ZDB-GENE-021231-4 nifk|OTTDARP00000021607 mki67ipl-003 LG_ BX548038.9 Danio rerio protein_coding KNOWN, 524 bp
ACGAGGCACAACGTGGTTTTAGGAGAAGCCATACGACAGT
AGGTTCAAAACGTTTAGCTTTATTTATTTGACCACTGTTA
GATTTCAATATGACAGAAGGCAAATCATCAGACAAGCCGG
CGAAAAGACTGCTGGCTCTGAATCCGAAAGAGGACGCAGA
ATTTCAGAAGAAAGTGCAGCAAGTGAAGAAGCGTCCTCAA
ACGACTGGTGGGAGCAAAGGCTATGGATTTGTGGAGTTTG
AGTGTGATGAAGTGGCTAAGATTGTGGCTGAAACCATGAA
CAACTACCTTATGGGAGAACGCATTATAAAATGTCACGTT
ATTCCACCTGAGAAGGTTCATGAAAAGCTCTTTGTCGGCT
CTATTGCTGGCTTCAAGAAGCCAAAGTATCCTGCAGTGAC
TCGGTATAACAAAACACACACAGAAGATGATGTGAAGAAA
GTTGGCACAAAGCTTTTAAGCAAAGAGTCTAAGCTGCGCA
AGAGACTGGCAGCAAAAGGCATTGACTATGATTTCCCAGG
ATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations