Transcript

nifk-201

ID
ZDB-TSCRIPT-090929-9001
Name
nifk-201
Previous Names
  • mki67ip-001
  • nifk-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026320 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026320|OTTDARG00000020890|ZDB-GENE-021231-4 nifk|OTTDARP00000021606 mki67ipl-001 LG_ BX548038.9 Danio rerio protein_coding KNOWN, 1344 bp
TTTGAATTGTCGCTTGCATTAGCAGTTTCCTGAACGAGGC
ACAACGTGGTTTTAGGAGAAGCCATACGACAGTAGGTTCA
AAACGTTTAGCTTTATTTATTTGACCACTGTTAGATTTCA
ATATGACAGAAGGCAAATCATCAGACAAGCCGGCGAAAAG
ACTGCTGGCTCTGAATCCGAAAGAGGACGCAGAATTTCAG
AAGAAAGTGCAGCAAGTGAAGAAGCGTCCTCAAACGGGTC
AAACACTTAGTCCAGGAGTGCTGTATGTTGGTCATCTTCC
TCGAGGACTGTTTGAGCCTCAGTTGAAATCTTACTTTGAG
CAGTTTGGCAAAGTCTTACGATTGAGAGTTTCCAGGAGTA
AAAAGACTGGTGGGAGCAAAGGCTATGGATTTGTGGAGTT
TGAGTGTGATGAAGTGGCTAAGATTGTGGCTGAAACCATG
AACAACTACCTTATGGGAGAACGCATTATAAAATGTCACG
TTATTCCACCTGAGAAGGTTCATGAAAAGCTCTTTGTCGG
CTCTATTGCTGGCTTCAAGAAGCCAAAGTATCCTGCAGTG
ACTCGGTATAACAAAACACACACAGAAGATGATGTGAAGA
AAGTTGGCACAAAGCTTTTAAGCAAAGAGTCTAAGCTGCG
CAAGAGACTGGCAGCAAAAGGCATTGACTATGATTTCCCA
GGATTTGCAGCACAGATTCCAGCTAAAAAGGCTCCATCAG
AAGCAAATGTTTCAGTGTGCAGTGAGGATGTAACTCCAGT
GTGCACACCTTCACTTTTGGAGAGGAGAAAGTCTCTCAGA
GTTGAGGATGATGATGTTGATGATGAAATAGTCATCAAAG
TCAAACCACTCCCAGAAAACAGTGATGATGTGGAAGAAAG
TGAGGAAGAGTCTGCTGAAGAGGATGAAGGTGAAGAGGAG
GAAGCGGCTTAAAAGGAGAATTTAGTGACTAATAAAGACT
TTATTCGCTGATTCAGAAGGGGACGCTGGACTCGCTTTTC
AGAGCCATTTGTATGCGATTAGTTCTCAGTTCTCCCCTAA
GGCTGGAGAAGAGGACCACACATATTACTCGCACACATTA
TCCTGATTGTCAGGAATCTGTTGATTTGAGGCGTGTTATG
CAGAGTTTGTGCCCGTGACCTTTTAAGGGTACAGTGTGGT
TGACCATAGAGTTGCTGAAATGACTGTATTAATCAAAGCA
GATGTATAGTGTTAATATGAAAATAATTATTTTCATTGTA
TTTGACACAATTTCTGTCCACATATGTTGCATTGCAATGT
TTGTAAAACATGTTTAAACCGTAAAATAAACTGTTTTAAT
AATTGTAAAGCATAATTTACTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations