Transcript

aplp1-202

ID
ZDB-TSCRIPT-090929-8885
Name
aplp1-202
Previous Names
  • aplp-001
  • aplp1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026192 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026192|OTTDARG00000020821|ZDB-GENE-040319-1 aplp1|OTTDARP00000021511 aplp-001 LG_ CR848749.13 Danio rerio protein_coding KNOWN, 5439 bp
GCTTTGGCCATGACAGAGGTGAATGGGCCAGTTGGGGGTC
CACAAGTGGCCGATCCTCAGATCGCCATGTTTTGTGGTCG
TCAGCTTCTACACATGAACACTGAGAGCGGACAGTGGGAA
CCGGATCCTCAGGGTCGACAGGGATGCTTCACCCAGCCCA
GCAAGATCCTCTCATACTGCCAGGAGATGTATCCAGGACT
GCAGATCTCTCATGTGGAAGAGGCTTCATCACCGGCGACC
ATCCAGGGCTGGTGTAAGAAGGGCTGGGGTCACTGTCAGA
CCCGCACCTTCATCGTGGTGCCCTACCGGTGTCTGGTAGG
TGAATATGTCAGCGAGGCTCTTTTGGTTCCAGACCGTTGC
CGTTTCTTACACCAGGAGCAGATGGACTCCTGCGAGAGCT
ACGTGTACTGGCACAACATCGCCAAAGAGGCCTGCACGGC
TGACAGTCTGGAGCTGCACAGTTATGGGATGCTGTTGCCT
TGCGGTGACCGTTTTCGCGGTGTGGAATATGTCTGCTGTC
CTGGCAGGACAGGATCGAGTGGACGTGGAGAAACAGAGAC
CGCAGATATTGTGCAGGGAGAAACAACACCACTCGTGTCT
ATGGCTGGAGACAAAACTATCACCAGTGTGAAAACAACAC
CGCCGACTCCCAGCCCTTCTCCTGAGACGGACATCGAGGA
AGACGATATGGAGGAGGAAGAGGATGAGGTGGTGGAGGAA
GAAGCAGAGGAGGAAGAGGAGGAGGAAGAGGAAGGCAATA
ATGAAGCAGCGGCTGAGGTCGAGGAAGCTGAGGAGGAGGA
AACCGCCACCACGGTCAAATACCAGGAGGAGTACGAGTAT
CCCATCGACTCTCATTTACAGGGCCAAGACTATATGGACA
ACTTCTACTATGACAAGAATCTCCAGACTGCCAAAGCCTC
CACCCAGCCTCAAACACGGATGGACAACATGCCCACTCCT
CGTCCTACAGATGGAGTGGACGTTTACTTCGAGATGCCAG
GGGATGACAGCGAACATGCCAACTTTCTCCGTGCCAAGAT
GGACCTGGAAGAACGACGAATGAAACGCATCAATGAGATC
ATGAAGGAGTGGGCAGAGGCAGACAACCAGTCCAAGAACC
TGCCTAAATCTGATCGCCAGGCACTTAATGAGCACTTCCA
GTCAGTCCTGCAGACTCTGGAGGAGCAGGTGGCCGGTGAG
AGGCAGAGGCTGGTGGAAACACACCTGGCCCGAGTGGTGG
CCACCCTGAATAACAACCGCAGACTGGCTCTGGAGAGCTA
CCTGAGCGCTGTGCAGAGTGACCCACCACAGCCGGACCGT
GTGCTTCAGGCTCTGAAGCGTTATATGGCCGCAGAGCAGA
AGGACAGACGACACACTCTTCGTCATTACCAGCACATCGA
GTCTGCAGACCCTCAGAAAGCAGAGCAGATGAAGTTCCAG
GTGTACACACATCTGCATGTGATTGAAGAGAGGATGAACC
AAAGTCTGGCTCTGCTCTACAAAGTCCCCGGCCTGGCTGA
AAAACTCCACGACGAAATCCAGGAGTTAGTGAGAACAGAG
AGAGGAGACATCAGCGAACTCATGACCACTTCCTTCTCTG
AGACGAGAACCACCGAAGAGCTGCTTCCTGCTGAGAGCGA
AGAAGAGCGAGACGATGAGGAGGAAGAGGACAGAGCTTTC
CAGAACAGACCATATCCACCACGCATCGATCCCCAGCCTG
TTGATAAGAAAGTTTCTTCAGTAGACGAGTATGACTACAC
CACCTCTGAGAGAGGACCCACTTATGAATATGAGGAGAAG
ATCAACACTTCAGTAGAGCTGAAGCAGGTGGTCTACAAGT
CTCCAGGAATCCAGAGAGATGAGCTGCAGCCAGACGTTTT
GGAGACGTTTAACCGTGGGGCAATGGTGGGGCTGCTGGTA
GTGGCGGTGGCCATCGCGATGGTGATGGTAATCAGCTTGT
TGCTAGTTCGCCGTAAGCCATACGGGACCATCAGCCACGG
CATAGTAGAGGTGGACCCAATGCTGACCCCTGAGGAAAGA
CAGCTCAACAAGATGCAGAATCACGGCTACGAAAACCCCA
CTTACAAATTCTTTGAGCAAATGAACTGAGGATGTCACAC
TCTCCCTTCTCGCCTCCCAGTTTTTCGATTGGGGTTTTCC
ACAACAACCCCCTCTCCCTCGTACTCTTCTGTATGTCTAT
CTGACCGATGTCCAAAAATGTACAACAAACCCGGCACGTA
AATAGGGAGTTTGTAGTAAAACGTTTGCATACTACTCTCT
TATCAAGGAGAGCCAGTAATAAGAGAATCCCCAACAAGAG
CATCTGAAATTCCCCGTTTTTTGCATCATTTCATAAGGAT
GTGACGTTTTAAAAAAAGCGCCACATTCTTTCCGGATGTG
TTTTTAAGGAAGCTCGACATTGAGTGCTTCCTTCTGTCAT
TTCTATTTTCAAAAAGCAGAGTTTATTTCATGGTGAAACT
GTGAGATGGGTGAAATAATATATTTTTGAGTTCCAGGGAG
ACGGTCATTGTAGAATAAGCCGCTATAGAGTCCTTCTGTT
TTAATAATAAGGCGAAAAAAAATCCAACAAGGTTTGTATT
CACGTATAAGTCAACCGTCGAACATTCTGGTAGATTATTA
GTCTCAATCACAGCCGTAAGAACTCGAGTCAGTGTTTTAA
ATGTACCACGAATGTTCATCGATCAACGCTACCCGGATAT
TTTTCTGGTATCGCTTCTTTAAAAAGTCAATTCTTAAGTA
ATCCGAAGTCCATACGCGTAAAGAAAAGCATGCAAAATTT
GGTGTATGATGCTATAACGTACTTGTGTTGGTCCTGTTTC
TTGCTTTTTGATAAAAACAACAAAAAAATATGAAAATATC
ACAGTGCAACGATGACGTGTAAATAACTAACGAATAGACG
TTTCTATCATTAATTTGTATCGACGCAACGTGTGGACGTA
AAAGATGACCTTGTGCTGCTCACACAGAGAACGAAACATT
TCCTATCATGGCTGAATGAAAACGGACTGTTGTAAAAACC
AGCACAAGAAAAATGACACAGTTAACTCCTGACTGAATGT
ATCTTCGGTAGACATAGGCTTCATTCACGTTCCTCCTAAC
ACGTGGTTAGTTAGCTTAGCTAATCCCTCCGTTTTCATAC
AGTAGTTGATTTACCTGTTGAGGGTTTGTGTTGCGTAAAC
AAATATTTTAAAGGTGGAAAACAACTTTGACTGACAAGGT
GTGATTGCGAAATTGCTTTCCCTCAGTCCTGAAAATCAAG
ATTGCTTTTCTTTTGATTGTCAGTCTAATGCATTTCTGTT
TTAGGTCTCAGTTTTTTAGCGTGCGTTGCTCTGACATGAA
TAACATTTGACACAATTTACTGGTAGTCAGTTGTAGACAG
AACACGTCTTGCTCGAATCATTTCATTAGTAGAACGGACA
GGTTTTTAAGGAAAATGTGGGATTATACAATGTTAATACA
TGACATATCAGCAGAAGTGAAACCAAAATGTTTTCAGTTT
CTTCAGTCCACTGTTATACAGTACGTATAAACCAAACCAA
ACTCTGTCCTCAGAAATCTTAATGTAATCTAAGATTATAT
TTATTTGACTTCTATTTTCTTCTGAGTCAAGACGGATCAA
ACCGTATGACATTACCATTCGTATTCGTCTTCCTTTGTTT
GTTCTGGAACCTACATTTTGAACAGGAACTGAAACCAAAC
CACAAAAATGCTAAGTTAGACACACCTAAATAGCATATAC
CACAAAATCAGAAGCATGTCGAGGTGTAATATTTATTTTT
AAGGCATCATTAGGCACAAAATGATCAATAAATATATTGT
TGTGAGGTGTATATGCAACCCAGGCTCATTCTGAAAAGGT
AGTCTTGCTGACGTTTCTGGAGACTGCAAATTATGTAGCC
GGTGTTACGTATAGCTGCATTTCATTTTTTAAGCGAACGC
TACGAGGCGGTGTGATGGCGATCTTTTTCGTGCTTACCTG
CTGACCGCTTACCTCTGTGTGGAGGGCTTTCCCGCCGCAA
CCAGTTTGTACGGTTAGCTCGTCGTGTACGTCGGCGGACT
TGAGACGCAGAAAGAAGCTGACCATGACGACGACGACCGG
GTTTGGGTCCGGAGAAGAGCGGTTTCAGAAATCAGGTACG
ACAAAAATATAATCCAAAAAAATTAAGTCATCAATTTCAT
AACAGGGTGAGGATGTGGTAAAATCCAAAAGCGTGGCAAA
AAAATAAAAATCAGACGAGGGCTTTTCTTTTTCTGGACAG
CTTTTGTAAATTGTTTGTTGGGTTTAGGGAAGCAAGCGGG
CGGGTGTGTCAATCGGTAAAACTGGTTGGGTTTAGGGAAG
GAGGAGGGTGGGTCAGCCGATTGGCCGGTCGCCCAGTCAA
TCATTCAGTCAGTCAGACAGACAGATGGTCGTTCGATAGC
GGCCTCTGGTGGGTTTACGAGAAAACAGCTCGGGCACGAA
CGGCACTCGGCGAGAGACATTTGAAATGCGAAGAAGCGCA
CACTGTGGCCTCTCGCGGATTCACATAAACAAAATCTGCA
AAAACACGTAATATATACGTAATAAATCCCGGGATGTATT
TCGCAGTTTCGCAGTTTCCAATTTAATCTCACATCCGTGG
GACAACATTTTCAGAATGAGCCTGGGTTGTGTACACGAGT
AATAATTGTGATCTGATGCTCTAATTTAAGATTCTTATAT
AAGATTTGGTACCAGCATCATCATGCAGATTTAGGACCAT
GTATTCAGTAGAGATCCATTTTAGGTTTGGCTGAGACGAC
TCCTCCCTCTTTATTCCTGAACCAATAGAAATGTAAACCA
ACTTACGGATGTTTTAACTGCTGCATTATTGCCTTTTTCA
ATGCTGTGTTTTTGGATGTAATTATATGTATTTTTTATTT
AAGTCGATATTAATTGGAGTTTGGGGTCATAATATACGGT
AGATTTTGACGGGTCTGACGCTTGATAACTAAACGAATTA
ACCGAGAGCACAACTGTATCCAGATTGACTCATTTGTGTC
CGTTCATCATTCATTAATGGAGAATCAGTACAGCGAAGGT
TAAGATGGAAACGCATTTAGTTTAGATCTAATGTGTTGAA
CATCATGTACAGCCCAAGTTTATCTGTCAGATTACTAGCA
TGTATTAAAGATACAGCTTGATAATTGGTTACTTTAAGAG
TGAAGGTGTAGTTTGGTGCTTTAAGGAACTTGTCATTAAG
CTATTGAAACCAATGTAATGATATAAGCTGATCTCGAATC
ACTCTGAAATCCACCAAAGACATGTTCTAGATATGATTGG
CAAGCCAAATAATGTGTTGTATTTTTAATTGACATGTATT
GTAAGAGCAAGCAACCTGTGAACTGATCTGGCTTGTTGTA
CTTGCATTAAAACGTCAATAAAATTATAAATGACCCACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations