header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8885
Transcript Name: aplp1-202
Previous Names: aplp-001, aplp1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026192 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026192|OTTDARG00000020821|ZDB-GENE-040319-1 aplp1|OTTDARP00000021511 aplp-001 LG_ CR848749.13 Danio rerio protein_coding KNOWN, 5439 bp
GCTTTGGCCATGACAGAGGTGAATGGGCCAGTTGGGGGTC
CACAAGTGGCCGATCCTCAGATCGCCATGTTTTGTGGTCG
TCAGCTTCTACACATGAACACTGAGAGCGGACAGTGGGAA
CCGGATCCTCAGGGTCGACAGGGATGCTTCACCCAGCCCA
GCAAGATCCTCTCATACTGCCAGGAGATGTATCCAGGACT
GCAGATCTCTCATGTGGAAGAGGCTTCATCACCGGCGACC
ATCCAGGGCTGGTGTAAGAAGGGCTGGGGTCACTGTCAGA
CCCGCACCTTCATCGTGGTGCCCTACCGGTGTCTGGTAGG
TGAATATGTCAGCGAGGCTCTTTTGGTTCCAGACCGTTGC
CGTTTCTTACACCAGGAGCAGATGGACTCCTGCGAGAGCT
ACGTGTACTGGCACAACATCGCCAAAGAGGCCTGCACGGC
TGACAGTCTGGAGCTGCACAGTTATGGGATGCTGTTGCCT
TGCGGTGACCGTTTTCGCGGTGTGGAATATGTCTGCTGTC
CTGGCAGGACAGGATCGAGTGGACGTGGAGAAACAGAGAC
CGCAGATATTGTGCAGGGAGAAACAACACCACTCGTGTCT
ATGGCTGGAGACAAAACTATCACCAGTGTGAAAACAACAC
CGCCGACTCCCAGCCCTTCTCCTGAGACGGACATCGAGGA
AGACGATATGGAGGAGGAAGAGGATGAGGTGGTGGAGGAA
GAAGCAGAGGAGGAAGAGGAGGAGGAAGAGGAAGGCAATA
ATGAAGCAGCGGCTGAGGTCGAGGAAGCTGAGGAGGAGGA
AACCGCCACCACGGTCAAATACCAGGAGGAGTACGAGTAT
CCCATCGACTCTCATTTACAGGGCCAAGACTATATGGACA
ACTTCTACTATGACAAGAATCTCCAGACTGCCAAAGCCTC
CACCCAGCCTCAAACACGGATGGACAACATGCCCACTCCT
CGTCCTACAGATGGAGTGGACGTTTACTTCGAGATGCCAG
GGGATGACAGCGAACATGCCAACTTTCTCCGTGCCAAGAT
GGACCTGGAAGAACGACGAATGAAACGCATCAATGAGATC
ATGAAGGAGTGGGCAGAGGCAGACAACCAGTCCAAGAACC
TGCCTAAATCTGATCGCCAGGCACTTAATGAGCACTTCCA
GTCAGTCCTGCAGACTCTGGAGGAGCAGGTGGCCGGTGAG
AGGCAGAGGCTGGTGGAAACACACCTGGCCCGAGTGGTGG
CCACCCTGAATAACAACCGCAGACTGGCTCTGGAGAGCTA
CCTGAGCGCTGTGCAGAGTGACCCACCACAGCCGGACCGT
GTGCTTCAGGCTCTGAAGCGTTATATGGCCGCAGAGCAGA
AGGACAGACGACACACTCTTCGTCATTACCAGCACATCGA
GTCTGCAGACCCTCAGAAAGCAGAGCAGATGAAGTTCCAG
GTGTACACACATCTGCATGTGATTGAAGAGAGGATGAACC
AAAGTCTGGCTCTGCTCTACAAAGTCCCCGGCCTGGCTGA
AAAACTCCACGACGAAATCCAGGAGTTAGTGAGAACAGAG
AGAGGAGACATCAGCGAACTCATGACCACTTCCTTCTCTG
AGACGAGAACCACCGAAGAGCTGCTTCCTGCTGAGAGCGA
AGAAGAGCGAGACGATGAGGAGGAAGAGGACAGAGCTTTC
CAGAACAGACCATATCCACCACGCATCGATCCCCAGCCTG
TTGATAAGAAAGTTTCTTCAGTAGACGAGTATGACTACAC
CACCTCTGAGAGAGGACCCACTTATGAATATGAGGAGAAG
ATCAACACTTCAGTAGAGCTGAAGCAGGTGGTCTACAAGT
CTCCAGGAATCCAGAGAGATGAGCTGCAGCCAGACGTTTT
GGAGACGTTTAACCGTGGGGCAATGGTGGGGCTGCTGGTA
GTGGCGGTGGCCATCGCGATGGTGATGGTAATCAGCTTGT
TGCTAGTTCGCCGTAAGCCATACGGGACCATCAGCCACGG
CATAGTAGAGGTGGACCCAATGCTGACCCCTGAGGAAAGA
CAGCTCAACAAGATGCAGAATCACGGCTACGAAAACCCCA
CTTACAAATTCTTTGAGCAAATGAACTGAGGATGTCACAC
TCTCCCTTCTCGCCTCCCAGTTTTTCGATTGGGGTTTTCC
ACAACAACCCCCTCTCCCTCGTACTCTTCTGTATGTCTAT
CTGACCGATGTCCAAAAATGTACAACAAACCCGGCACGTA
AATAGGGAGTTTGTAGTAAAACGTTTGCATACTACTCTCT
TATCAAGGAGAGCCAGTAATAAGAGAATCCCCAACAAGAG
CATCTGAAATTCCCCGTTTTTTGCATCATTTCATAAGGAT
GTGACGTTTTAAAAAAAGCGCCACATTCTTTCCGGATGTG
TTTTTAAGGAAGCTCGACATTGAGTGCTTCCTTCTGTCAT
TTCTATTTTCAAAAAGCAGAGTTTATTTCATGGTGAAACT
GTGAGATGGGTGAAATAATATATTTTTGAGTTCCAGGGAG
ACGGTCATTGTAGAATAAGCCGCTATAGAGTCCTTCTGTT
TTAATAATAAGGCGAAAAAAAATCCAACAAGGTTTGTATT
CACGTATAAGTCAACCGTCGAACATTCTGGTAGATTATTA
GTCTCAATCACAGCCGTAAGAACTCGAGTCAGTGTTTTAA
ATGTACCACGAATGTTCATCGATCAACGCTACCCGGATAT
TTTTCTGGTATCGCTTCTTTAAAAAGTCAATTCTTAAGTA
ATCCGAAGTCCATACGCGTAAAGAAAAGCATGCAAAATTT
GGTGTATGATGCTATAACGTACTTGTGTTGGTCCTGTTTC
TTGCTTTTTGATAAAAACAACAAAAAAATATGAAAATATC
ACAGTGCAACGATGACGTGTAAATAACTAACGAATAGACG
TTTCTATCATTAATTTGTATCGACGCAACGTGTGGACGTA
AAAGATGACCTTGTGCTGCTCACACAGAGAACGAAACATT
TCCTATCATGGCTGAATGAAAACGGACTGTTGTAAAAACC
AGCACAAGAAAAATGACACAGTTAACTCCTGACTGAATGT
ATCTTCGGTAGACATAGGCTTCATTCACGTTCCTCCTAAC
ACGTGGTTAGTTAGCTTAGCTAATCCCTCCGTTTTCATAC
AGTAGTTGATTTACCTGTTGAGGGTTTGTGTTGCGTAAAC
AAATATTTTAAAGGTGGAAAACAACTTTGACTGACAAGGT
GTGATTGCGAAATTGCTTTCCCTCAGTCCTGAAAATCAAG
ATTGCTTTTCTTTTGATTGTCAGTCTAATGCATTTCTGTT
TTAGGTCTCAGTTTTTTAGCGTGCGTTGCTCTGACATGAA
TAACATTTGACACAATTTACTGGTAGTCAGTTGTAGACAG
AACACGTCTTGCTCGAATCATTTCATTAGTAGAACGGACA
GGTTTTTAAGGAAAATGTGGGATTATACAATGTTAATACA
TGACATATCAGCAGAAGTGAAACCAAAATGTTTTCAGTTT
CTTCAGTCCACTGTTATACAGTACGTATAAACCAAACCAA
ACTCTGTCCTCAGAAATCTTAATGTAATCTAAGATTATAT
TTATTTGACTTCTATTTTCTTCTGAGTCAAGACGGATCAA
ACCGTATGACATTACCATTCGTATTCGTCTTCCTTTGTTT
GTTCTGGAACCTACATTTTGAACAGGAACTGAAACCAAAC
CACAAAAATGCTAAGTTAGACACACCTAAATAGCATATAC
CACAAAATCAGAAGCATGTCGAGGTGTAATATTTATTTTT
AAGGCATCATTAGGCACAAAATGATCAATAAATATATTGT
TGTGAGGTGTATATGCAACCCAGGCTCATTCTGAAAAGGT
AGTCTTGCTGACGTTTCTGGAGACTGCAAATTATGTAGCC
GGTGTTACGTATAGCTGCATTTCATTTTTTAAGCGAACGC
TACGAGGCGGTGTGATGGCGATCTTTTTCGTGCTTACCTG
CTGACCGCTTACCTCTGTGTGGAGGGCTTTCCCGCCGCAA
CCAGTTTGTACGGTTAGCTCGTCGTGTACGTCGGCGGACT
TGAGACGCAGAAAGAAGCTGACCATGACGACGACGACCGG
GTTTGGGTCCGGAGAAGAGCGGTTTCAGAAATCAGGTACG
ACAAAAATATAATCCAAAAAAATTAAGTCATCAATTTCAT
AACAGGGTGAGGATGTGGTAAAATCCAAAAGCGTGGCAAA
AAAATAAAAATCAGACGAGGGCTTTTCTTTTTCTGGACAG
CTTTTGTAAATTGTTTGTTGGGTTTAGGGAAGCAAGCGGG
CGGGTGTGTCAATCGGTAAAACTGGTTGGGTTTAGGGAAG
GAGGAGGGTGGGTCAGCCGATTGGCCGGTCGCCCAGTCAA
TCATTCAGTCAGTCAGACAGACAGATGGTCGTTCGATAGC
GGCCTCTGGTGGGTTTACGAGAAAACAGCTCGGGCACGAA
CGGCACTCGGCGAGAGACATTTGAAATGCGAAGAAGCGCA
CACTGTGGCCTCTCGCGGATTCACATAAACAAAATCTGCA
AAAACACGTAATATATACGTAATAAATCCCGGGATGTATT
TCGCAGTTTCGCAGTTTCCAATTTAATCTCACATCCGTGG
GACAACATTTTCAGAATGAGCCTGGGTTGTGTACACGAGT
AATAATTGTGATCTGATGCTCTAATTTAAGATTCTTATAT
AAGATTTGGTACCAGCATCATCATGCAGATTTAGGACCAT
GTATTCAGTAGAGATCCATTTTAGGTTTGGCTGAGACGAC
TCCTCCCTCTTTATTCCTGAACCAATAGAAATGTAAACCA
ACTTACGGATGTTTTAACTGCTGCATTATTGCCTTTTTCA
ATGCTGTGTTTTTGGATGTAATTATATGTATTTTTTATTT
AAGTCGATATTAATTGGAGTTTGGGGTCATAATATACGGT
AGATTTTGACGGGTCTGACGCTTGATAACTAAACGAATTA
ACCGAGAGCACAACTGTATCCAGATTGACTCATTTGTGTC
CGTTCATCATTCATTAATGGAGAATCAGTACAGCGAAGGT
TAAGATGGAAACGCATTTAGTTTAGATCTAATGTGTTGAA
CATCATGTACAGCCCAAGTTTATCTGTCAGATTACTAGCA
TGTATTAAAGATACAGCTTGATAATTGGTTACTTTAAGAG
TGAAGGTGTAGTTTGGTGCTTTAAGGAACTTGTCATTAAG
CTATTGAAACCAATGTAATGATATAAGCTGATCTCGAATC
ACTCTGAAATCCACCAAAGACATGTTCTAGATATGATTGG
CAAGCCAAATAATGTGTTGTATTTTTAATTGACATGTATT
GTAAGAGCAAGCAACCTGTGAACTGATCTGGCTTGTTGTA
CTTGCATTAAAACGTCAATAAAATTATAAATGACCCACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aplp1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026192 (1),  Ensembl_Trans:ENSDART00000166203 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY271745 (1) 1500 bp
GenBank:EE318401 (1) 867 bp
GenBank:DN903287 (1) 799 bp
GenBank:DT075727 (1) 731 bp
GenBank:CK696084 (1) 702 bp
GenBank:AW281090 (1) 687 bp
GenBank:DN857138 (1) 658 bp
GenBank:EB946594 (1) 601 bp
GenBank:EB774421 (1) 542 bp
GenBank:AW281421 (1) 491 bp
GenBank:BM005446 (1) 469 bp
GenBank:BI842246 (1) 451 bp
GenBank:AW281680 (1) 449 bp
GenBank:CR926570 (1) 411 bp
GenBank:EB780816 (1) 367 bp
CITATIONS (2)