Transcript

utp25-201

ID
ZDB-TSCRIPT-090929-8876
Name
utp25-201
Previous Names
  • def-001
  • diexf-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026183 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026183|OTTDARG00000020813|ZDB-GENE-021217-2 diexf|OTTDARP00000021503 def-001 LG_ CR559941.5 Danio rerio protein_coding KNOWN, 2720 bp
ACTATCCATGAAGAAAAGAAAACAGGAGCTGGTTACACAC
GTGTGTGTAGATGTAGAACAGAAACATGGGCAAAAGAAGG
CGAGGAAAACAGGAGATTGATAATTTAACTAAGAAACAGA
AGAAACATCTAAAGGAATTTGGTGAACAACACCCTTTTCA
CGATAAGGTTGTTGAAAGACCGGAGAAGACTCAGATTTTG
CGCTTGCCTGACAGTCCACAGCGCCCTGAACCAGACAGTG
AGGATGACAGTGATGCTGAGCAACCATCTGCATATCAGAA
ACTACTGTCCACCATGATTCAAGGTGATGAAGATGATGTT
GAGAGTGAAGATGAAGAAAGCGAGGAAGAGGATAACGAGG
AGGAAGCTGAAGTTGAAGGTGATAGTGAAGAAGAAGTGGA
GGACACCGATGAAGAGGACGGGAATGATGCTGAGGAAGTT
TTAGAGGATAAAGTGGAAGAAACATCTGACAAATTACAGA
AAAAACACCCTGAAAAGACCAATGGAGATGTAGAGGAGAA
TGAAGAGGCAGAGATGGAGGGAGAGTTTACAGATAAAAAG
AATGAAGCTGCTTTCTGCTTGGAGACCAATATGCCTGCAG
AAGGAGAGGAAAACACAGCACAACAGGAACAGGATGAAGA
CATGTTTGTGAAGCACCAAGAGATTGAACTGAGCGAAGAG
GAAGTGGGACGAATCTCACAAGGATCAAAGGTCAAGACTC
AGGTTAAGTGGGCAAAACTGGGTGTTCTGCAGTGCATGTG
TCCATTGGAACGTTTTCCAGCCATCGGACAGGCCTCTTCT
GCCCCTCTTCCACCCATTCACAAAACCCTAGAGGCAAATT
GGCATTTGTTAAACCTGCCTTTTGGAGCTGCAACAGATGT
CACAGAGCTGCAAAAGGAGATGCTTGGGCTCATGGGTACT
TACAGAGACCTCTATTTGGCAAACCTCTCCCCCTTGAAGG
AGGCTAAGGAAGTGCGCAGCGCATACTGTCTTCATGCCCT
GAACCATGTATTAAAGGCCAACTCTCGTGTGCTTAGAAAC
AATGCCAAGTTAAAGGAATCTAAAAATGGGGATGAGGATT
TTCGTGACCAAGGGCTTACTAGACCAAAGGTCTTGATTTT
GGTGCCATTCAGAGATGGAGCACTGAGAGTTGTCCAGACC
TTCATGACACTTCTGGAGCCCAAAGGCAAGAAGACGGATG
CCAGTAACAAGAAACGCTTCAAGGAGGAATATGGAGAGGA
GACGGATGAGAAGCCACCTAATCTGCAAAGGCCTGATGAC
TACCACGCTGTCTTTTCTGGAAATATAGATGATCATTTCA
GGATAGGTATGTCTATCCTGAGACACAGCATGCGCCTATA
CGCTCCCTTCTATTCCTCTGACATCATCATTGCTTCTCCG
CTGGGTCTCCGCACAGTTCTGGGTGCTGAAGGGGAGAAGA
AAAGAGACCATGACTTTCTGTCTTCAATCGAACTTTTGAT
TGTGGATCAGGCAGATGTTTTCCTCATGCAGAACTGGGAA
CATTTACTCCATGTGTTGGAGCATTTGAACCTGCAGCCGC
TGGACTCTCATGGTGTTGATTTCTCTCGCGTTCGCATGTG
GAACCTAAACAACTGGGCAGCTTATTACAGACAGACGCTG
GTGTTCAGTGCCATACAAGAACCTCAGATCACCAACATCC
TCACCAAACACTGCCACAACTACAGAGGCCAGGTGTGCAG
TAAAACCATTCCAAAGATAGGCTCAATCTGTCAGGTACTT
GTGCAGCTGCCACATGTTTTTCAGATGTTTCACTCTGACA
GCTTCATGGACCAGGATGCCAGGTTCCAGTTCTTTGTGGA
TAAGATCCTGCCTCAGTACAGAGACTCTGTCATGTCCCAC
ACTTTCATCTATGTGCCTTCGTACTTTGATTTTGTACGTC
TGCGAAACTACCTGAAGAAGGAAGACGTCAGTTTTGCTAA
TATTAGCGAGTACTCTCAGAGATCAGAGGTGTCTCGAGCG
CGACATTACTTCCAGAAAGGAGAAAAACAGTTTCTGCTCT
TCTCTGAGAGATTCCACTTTTATAAGAGATACACTATCAA
GGGTATCCACAATCTGATCTTCTACGGGTTGCCCACATAC
CCTCATTTCTACAGTGAGGTGTGTAATATGCTTCAGGCTG
GAGTCAGAGAGGGTGGTGCTTCTGTCAGCTTCACCTGCAC
GGCTCTGTACTCTCGATATGATGTGCACCGTCTGGCTGCC
ATCACCGGGGCTGACCGCGCCGCTCAGATGCTTCAGTCCA
AAAAAACCACACACCTCTTCATCACGGGGGAGGAGAAAAG
CACATGAAGAGGTACTGCGAAAATCTGATGTGACGTTTTA
ATCTCTCCGAGAAGGAAGATAATCTGTGTTGGTGGTAGTG
GGTAAAATGATGTTTTCCCTTCTGTCATATGACTGAATTT
AATGATGATATTCCCTTTCCCTTTTATATATAAAGTCTTC
TTTTGCTATTGTCAGCCCAGATGTTTTACTTTTCATGTGT
TTAAATGGGTGAAATTAAGGTTTTTAAACTTTCAATTTCC
TAAGACATTTGGGAGCGCGGGAAATTGGGCCTCAATAATT
ATTTCCAAAATGTGTACAACAAAGCTCATGCCAGCAATCA
TGCCAGCATGTAGGAGAATCTAACCAGCAGTCACCTGTCT
AATTATTATATCTTAGTATCCATGAAATAAACCTTCGGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations