header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8804
Transcript Name: scarf1-202
Previous Name: scarf1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026111 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026111|OTTDARG00000020763|ZDB-GENE-030131-8778 scarf1|OTTDARP00000021444 CH211-209M4.2-001 LG_ CR522882.5 Danio rerio protein_coding KNOWN, 3705 bp
GGAAACTTGCAGAGGAAACAAAGGGATTCGGAGAGCCCAT
TTTGCTAAAGGGACTCGACTGGATCTTTTCTGTTCCACTA
ATACAAAACTAACCTGTACTGGTGCTGTGGTGGGAGAAGG
TGGCACAGGTTTTGGTCGGTCCGGAGGGAATGGACACCTT
TCTGACCTCATTTGGACTGATGCTCATGTGTGTCCAGTAC
TCAGCTCAGAGACTCTCTCTGACCGGGAAGAACGTCTGCC
TCAGTGTCAGGGATTCCTCTGCAATATGTTGTTCTGGATG
GGGCCAGAGCGGTGATGAATGCACTGTCCCTCTCTGTGAG
GGAGAAAGAGCCTGTCTGCAGGATGAAGTGTGTGTTTACC
CTGGACTCTGTCGATGTAAAGCTGGATTTTACGGGTACCA
GTGCAAAGCTCCTTGTCCTCCTGAGTTTTGGGGACCAGAC
TGTCGCGAGTTCTGTCCCTGCCACCCTCACGGACTCTGTG
ATCCAGCCACTGGCGTATGCTCATGCCTGCCCAACCGCTG
GGGCAGCTTGTGCCAGAACAGCTGCAAATGTGGCCGCCAT
GGCAAATGTGACCCTGTCTATGGGAACTGCACCTGTGAGG
AGGGCTGGTGGACATCCACTTGCTCCAAAGCATGTCAGTG
CCACCTCGCTACCTCCACCTGTGACCAAGCCACAGGCCGC
TGCATTTGCAATGAGGGCTATTGGGGCCAAAAGTGCAGCC
TGCCATGCAACTGCTATGTGTCCCCTTGTCAGCAGCGCAC
TGGGACATGCCAGTGCCTGCATGGCTGGTGGGGCCCGTCC
TGTGACCGCCGCTGCATTTGCAATCTCAACAATGCTGACT
GTGATGTGCAAACTGGTGGCTGTTTGTGCTACCCAGGTTA
CAAAGAGCCTTTCTGCAATGAGCCTTGTGACAGTGGAAAA
TATGGCCGAGGCTGTAAGAACAGCTGTGGACGTTGTGAAG
GAGGCAGGCCTTGCTCTAAGCTGGACGGCCTGTGTGATGC
CTGTGAACCAGGATGGAATGGCACTCGCTGTGATCAACGC
TGTCCTGCGGGTTATTATGGCCATCGCTGCCAAGAAATTT
GTCCGCATTGTCGAAACATGGACCCATGTGACCCGGAAAC
TGGTGCATGTTTGCAGTGTAATCCTGGCTGGACTGGACCA
AGATGTGACAAACCCTGCACAGATGGTAGATACGGAGATG
GCTGTCGCTTCCTCTGTAAAACTTGCAATCATGGCCACTG
CGACCATGTGACAGGAAGATGCATTTGTCTTCCTGGCTTT
CAGGGTGAGAGCTGTAACAGCACATGTCCTTTTAATCTTT
ATGGCTTCAACTGCTCCTCCACATGTGATTGTGGAAGTCA
AGCCTGCCATCCAGCCACTGGGGCTTGTCCAAACAGTATC
AGAGCTGGTCTTTTAGCAGGGCTTTTGATTCCTCTCTGCA
TATTAATACTCGCCTTGTTGTTCTGCTGCTGCTGTTGTGG
GAGGCCAGTCGAAGGAAAGGAAAGGGTCACAGTTGGAGAT
GGCAGTCCTGCAGTCCGCATGAAGCACCATGTTTATACTG
TGTTGGCCAACATGGGTTCAGCAATGCCTTGCATCACTCT
TTGGTCATCTGGTTTGCCCAGGGTTACTGTCTCGCATCAT
GATCCTGAGCTCACATTTAACCACAGCTTCATCGAGCAGC
CATCATCCGGCTGGGTAATAGATTCATTCGAAACTGATGA
GGATGGAGAAGCTGTTTACTGCGAACCACCCAGGGAAGAT
GTTCTTACAGAGGCCGGCGGAGAGCTTCAGGAGCTGAATT
CCAAGTGTAACTTCTTCCCTGACCCATCAACCTTCAGCAG
CGAGGACATGTCACAAGCTTTTGGCATCCCCCGTACCTCC
AGCATCGCCAAATCCAAACGCCCTTCAGTGTCATTCGCAG
AGGGTACAAAGTTCAGCCCAAAAGAGCGTCGCAGTTCAAC
TCAAGATCTGCAAGGGACCGCTCGAAAACCCAAACCCTGG
GGTGTCCTGATGATCTCCGCCCTGCAAGGAGGACAGGGAA
ACCAGAATAACGAAACGGAAACAGAGAAAGAAGAAAAAAA
CGATGAGGAGAACATCTCTGAGGAGCAAAGAGCTTCCTCT
GAAACACTACAAAATGATTCGGAAAGATATAGTTCGGGCC
CACAGAGAACTCACCTCACTGTACCCGGTGGAAGACGACG
CACTCTTTCTAACCCCAAAAAGAACATCCAGTCATCTGAC
GGCGGACAGGACGCAGATTCAGAGAAGTTAACAACAGTAT
ACGTTACTGTAGGTAAGACCTCCAAAATGGTCAAGCAAGA
GCCTCCTTCAGAAGGGCCTGTTCAGGCGATGCTGCGCAGA
CTAGGAAGCCTCCAGAGGCAAAAAGAAGAAGTTGCTAAAG
GCAAGGCCCAATCGATTGTTAAGCCTCCACGGAGGAAACT
AGGTGCCCGAGCCAGTGCATGGGAGCAAGCGAGCGGGTCA
GGCCAATCAGAAGTGGTCATGAGGAAACCCAGTCGTAAAA
AACACAGCTCTCTCAGCTCTCCATGCATAGTCGGGGCAAT
AGACTCTCCTCAAGAGAACAGCGCCCCCAAGAGGCCGCTG
TCCTCCATTTTAAAAAGTGTTCCTGAGAGTGATCCATTTC
AAAGTTTAGAGGTGGAACCGAACAGTGAGGAGACTGGCAT
ACAGACTGAGCACACTTATGAGACTGTGGCTCTGCCTGAC
ACTGTGTCCACCTCTTCAGAGATTATTATTAATGACACAG
TTATGGACCAAGCAGAAAATGAGCCCAATTATGAGAATGT
TTATTTAAAGCATTGATAACACTGCTACATCTTATGCTTT
TAAGAGTGTGTTCACAATTTAATTATTTTGGTTTAACAGA
TTCCGAACCAATAATGAAAAAATATTTGTTGAAGTCAAAA
TGATTAGCCCTCTTGTGAATTTCTTTTTCTTTTTCAATAA
TTTCCTAAACGATGTTTAACAGAGAAAGGAATTTTTTTTT
TTTTACTGTATTTCCTATAATATTTTTTTTTTCTTTTGGA
AAAAGTCTTATTTGTTTTATTTGGCTAGAATAAAAGCAGT
TTTATTTTTAACAAATTATTTTAAGGTCAATATTATTAGC
CTCCTTAAGCAATATTTTTTCCTCGATTGTCTACAGAACA
AACCACTTATGCAATGACTTGCCTAATTAACCTTGTTAAG
CCTTTAAATGTCACTTCAAGCTAAATACTAGTATCTCGAA
AACTATCTAGTAAAATATTATGGACTGTCATTATGGTAAA
GATAAAAGAACTCAGTTACTAGAAATTAGTTATTAAAACT
ATTATGTTTAGAAATGTGTTGAAAACTACATACAGAAAAG
TATATACAAAAAATAATAACTCTAATAATTATTATTTAAA
TTATACTACTAATTCTGACTTCAACTGTATATTTAGCAAC
AGATATAGTTTTAAACACATTCATTCTATGTGTATGCATG
TGAAGACATTTTATCATTTGAGAACTAAATTGTGTAAAGG
CAAAAAAAGACGCACAAATCAAAATCTACTACAAACTTTT
GAGACAAATTTCTGACATCTGTAGGTGAACGAGTAATATT
GTGCCTATGAAGAGAAACATCTGTGAACACACTCTTAAAG
GGCATTACTTTCTTCTTTAACTTGTACTGTATGTTTTAAT
TATATAAACACATCTGCTTAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
scarf1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026111 (1),  Ensembl_Trans:ENSDART00000138401 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY732220 (1) 1115 bp
GenBank:CT726283 (1) 804 bp
CITATIONS (2)