Transcript

tbx2b-201

ID
ZDB-TSCRIPT-090929-8773
Name
tbx2b-201
Previous Names
  • tbx2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026080 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026080|OTTDARG00000020747|ZDB-GENE-990726-27 tbx2b|OTTDARP00000021423 tbx2b-001 LG_ AL954322.4 Danio rerio protein_coding KNOWN, 2616 bp
ATGTGAGATAGTTACAGTTGTACAGTGGACAGGGCAAGAT
CTAACCATTTCAACTCCGTGTCTGGGTAGAATGACTGCGC
TTGAATGGACATCCGCATCGAAAGAGTAATCTGCTTTTTT
ATGAGAGCAACTGTTGGCGAACAGGAATCCCCAAATCTGC
CTTCAAAGCGTCCTTGCGCTCACTTTGACTGATATTATTA
CGGGGACTTCGTGGAAACTAGCAGCTACGGGAGTTAAAGT
GGAAGATCCTACCGCTGTCTGCTCTCGCCTTTTCGCGATA
CGCATTTTGCCAAAATTGCCTCGCTGCGCTTTTTCTTCTC
GTAGTGAGAAGATCTGTCTTCTGGATACGCGCTCCTTTTT
AGCCAGAGAACACCTCTAAATATATCTTTTCACTACGTTT
GTTGGATGCACCGATGAGAGATCCAGTTTTTACAGGGACT
GCGATGGCTTACCACCCTTTCCACGCTCACCGGCCGACCG
ACTTTCCCATGTCAGCTTTTCTCGCGGCCGCGCAACCTTC
CTTTTTCCCGGCGCTGACCTTGCCTCCCGGGGCTCTCACA
AAGCCGATCCCGGACCATACCCTGGCCGGAGCCGCGGAGG
CTGGGCTCCATCCGGCTTTGAGTCACCACCATCAGGCAGC
TCATCTTCGCAGTCTCAAGAGCTTGGAGCCAGAGGAAGAG
GTTGAAGACGATCCAAAAGTCACACTGGAAGCGAAGGATC
TATGGGACCAGTTCCACAAATTAGGAACAGAAATGGTTAT
TACGAAATCTGGCAGGAGAATGTTTCCACCTTTTAAGGTC
CGCATTAATGGACTCGATAAAAAAGCCAAGTATATTCTTT
TAATGGACATTGTGGCTGCCGACGACTGCCGCTACAAGTT
TCACAACTCTCGCTGGATGGTTGCGGGGAAGGCCGACCCG
GAGATGCCAAAGCGAATGTATATACATCCGGATAGCCCAG
CTACTGGGGAACAATGGATGGCTAAGCCTGTTGCTTTTCA
TAAACTGAAGTTAACCAACAATATTTCGGACAAACATGGA
TTTACCATCCTGAATTCAATGCATAAATATCAGCCCAGGT
TCCATATTGTGAGAGCCAACGATATTCTGAAGCTTCCGTA
CAGCACTTTCAGGACATACGTTTTCCCTGAGACCGATTTT
ATTGCTGTCACTGCTTATCAAAACGACAAGATAACTCAAC
TGAAAATTGATAATAACCCCTTTGCCAAAGGCTTCAGAGA
CACGGGGAATGGAAGGAGAGAAAAAAGGAAACAGCTGACC
CTTCCATCATTACGCATGTATGAGGATCAATGTAAAGTGG
ACCGTGATGGCGCCGACTCTGATGCTTCCTCAAGCGAACC
AACAACTGGCAGAGATGCTGGTCATTCACCTGGACCGGTT
TCCAGCCCACTTAGGTTTAACCGGGGCAGCAGAGACGACA
AAACATGCACTGATAGCGAGCACGAAATGGACCACCAAAA
TGACCGGTGTGGTGGCTCCAGCAGTCCTGCACCAGAGCCT
TCATCTCCATTCAGGTCGAGGAGTGAGGACTGGGGGCGAG
AGAAGCCTATTGCGGAGAAGAAAGACGACTATCCAGACTC
ACGAAAAACAAGTGATTCTATATTTAGTATAAGAAACTTG
GAGAAAGACAAACTAGAGAGCAGGTCGAGGAAAGATACAG
ACTCGTCAAAGAAAGACACGGAAAACAGCGGTATAAGCGG
TAGTAAAGACAGCTTCTCTCCTCTAATGGTACAGACTGAA
AGTCCTTCACATTTTGGGGCAGGGCACCTTCAGAGTCTGG
CGCTCTCCGGCCTACACAGTCAACAATTCTTTAACCCACT
AAACACCGGACAACCTCTATTATTCCACCCTGGACAATTT
GCAATGGCACCTGGAGCGTTTTCTGCCATGGGCATGGGAC
ATCTATTGGCTTCAGTATCAGGCGCTGGTGGCCTGGAGAA
CGGAAGTCTGTCAGCTCAGGGTACTGGGAGCACACCGAGT
CCCTTTCCCTTTCATCTGTCTCAACACATGCTTGCCTCTC
AGGGCATTCCGATGCCAACCTTCGGTGGACTTTTCCCGTA
CCCCTACACCTACATGGCCGCGGCAGCAGCAGCGGCTTCT
GCCCTGCCCGCTAGCAGCAGCACGGCGTCCTCTCTCTCCA
GGAACCCGTTCTTGAGCAGCAGCACTCGCCCTCGACTGCG
ATTCAACCCTTATCAGCTCCCAGTGTCGATCCCTCAAAGC
ACAAACCTGCTCACCACCGGATTGCCAAGCGGCCTAAACC
CCTCATCGGAATCTTCTAAATGTGGTAGCAGGGAAGCGAG
TCCTGTGCCTGATCACAAATCGGGAGCCAGTCAAAGAAAC
GGCTCACCTAAAACGACAATGAAGGAATCCATCAATGAAC
TTCAAAATATCCAGAGACTAGTAAGCGGCCTAGAGAGCCA
GCGGGAGACTTCGTCACCTAGGGATTCACCCAAGTGATCA
AGCGTCCCCAAACCTATCCAGGGCATGACTTGAATTGCCA
GAGGATTTTATTAAGTTGTTCTCGGCGAGAAATTTCATTA
TATTTTGCGCATGGATGATTAGAGTGGAAAACAAGAAGTC
AACAAGAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations