ZFIN ID: ZDB-TSCRIPT-090929-8748
Transcript Name: gdpd1-202
Previous Name: gdpd1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026053 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026053|OTTDARG00000020733|ZDB-GENE-040822-22 gdpd1|OTTDARP00000021402 gdpd1-002 LG_ BX571762.15 Danio rerio protein_coding KNOWN, 523 bp
ATATGTAAACTGCGCAGGGGGATGGCCTGTCAAGAAACAT
TGGACTGCAAGCCCATGGGATTCGCTCGGGTTTCTTCTGA
TCGCGGATACAGTGCGGCGGCGGCTGGCCAGCGGTGCTGG
ATGAAACCGGCCGGTGCGGTGACACTTACTTTTCAATGAA
TTTTTCATCAAACAAGTGATTTTACAGGACTTACTCGCTT
GTCCGACTGAATAAAGTGAAAATGAGCGCCGTGGTTTACG
TTTTATCCACGGTCACCGGATATGTGCTAACCTCGGCGTT
TCTGCTGAAGTGTCCGTCTCTGCTTCACCGGCGAAAGAGA
GAAGCCTTCCGGAGCAGACACATCTCTCACCGCGGCGGGG
CTGGTGAGAACTTGGAGAACACAATGGCAGCCTTCAAGCA
TGCTGTTAAACTAGGCACGGACATGTTGGAGCTGGACTGT
CATTTGACCAAGGATGAGCAGGTGGTGGTATTGCATGACT
CCAGCCTGAAGAGGTCGACTGGCATTAATGCATACGTTGC
TGA

gdpd1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gdpd1-201 (1)    Ensembl 2665
gdpd1-202 523
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gdpd1-202 Contained in:
[BAC] CH211-214G1 (1)

Genome Resources: Vega_Trans:OTTDART00000026053 (1),  Ensembl_Trans:ENSDART00000139296 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT060490 (1) 564 nt
CITATIONS (2)