ZFIN ID: ZDB-TSCRIPT-090929-8747
Transcript Name: gdpd1-201
Previous Name: gdpd1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026052 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026052|OTTDARG00000020733|ZDB-GENE-040822-22 gdpd1|OTTDARP00000021401 gdpd1-001 LG_ BX571762.15 Danio rerio protein_coding KNOWN, 2665 bp
GTAAACTGCGCAGGGGGATGGCCTGTCAAGAAACATTGGA
CTGCAAGCCCATGGGGTGGGTTTTCAAAGAAATGCATGAA
GGTGGAACTAAAGCAGGGTCTAATCTTACTGATACTATAT
GTTCTGTCTTGAAGATTCGCTCGGGTTTCTTCTGATCGCG
GATACAGTGCGGCGGCGGCTGGCCAGCGGTGCTGGATGAA
ACCGGCCGGTGCGGTGACACTTACTTTTCAATGAATTTTT
CATCAAACAAGTGATTTTACAGGACTTACTCGCTTGTCCG
ACTGAATAAAGTGAAAATGAGCGCCGTGGTTTACGTTTTA
TCCACGGTCACCGGATATGTGCTAACCTCGGCGTTTCTGC
TGAAGTGTCCGTCTCTGCTTCACCGGCGAAAGAGAGAAGC
CTTCCGGAGCAGACACATCTCTCACCGCGGCGGGGCTGGT
GAGAACTTGGAGAACACAATGGCAGCCTTCAAGCATGCTG
TTAAACTAGGCACGGACATGTTGGAGCTGGACTGTCATTT
GACCAAGGATGAGCAGGTGGTGGTATTGCATGACTCCAGC
CTGAAGAGGTCGACTGGCATTAATGCATACGTTGCTGATG
TGGCTTATGCTGATCTTCCTCCTTACCTCTGTAAGCTTGG
GGTCAGTTTCAAACGAGACTGCTACTGTGAAGGAGGAGAA
GACAAACGCATCCCCCTGCTGAGAGACGTGTTCGAAGCTT
TCCCAAGCACCCCGGTAAACATCGACATCAAGGTCAACAA
TGACACCCTCATCAAGAAGGTGTCTGAGCTGGTCATTCAG
TATAAAAGGCAGGATCTGACCGTCTGGGGAAACTCCAGCA
ATGAAATTGTTAAGAAATGTCACAAAGAGAATCCACAAAT
CCCAATCTTGTTCAGTTTGCCTAGGGTGCTTCTGTTACTA
GGTCTATTCTACACTGGCCTTCTGCCCTTCGTCCCAATAA
AAGAACAATTCCTGGAGATTCCCATGCCTTCAATTGTTTC
CAAGCTCAAAGATCCTCAGCGCCAGACACGGAGTCAGCGC
TTCATAACATGGTTGGCTGACAAGGTCCTCATGAGGAAAT
CTCTGTTCGATCATCTGACAGGCAGAGGAATACAGGTGTA
CATCTGGGTGTTGAACGACGAGGAGGACTTTCAACGTGCC
TTTGACCTTGGAGCTACAGGAGTTATGACAGACTATCCCA
CCAAGCTAAAGGAGTTTATGGAGAAAAACAACTACACTAC
CACCATTAAATAGGACTTGCTGGCCAAAGTAAATGATCAA
TATGGTTTTCCATTGATCTTTGGCCTCTAAATGGGTCTTT
TAATTACCCCAAAGTCTGTGATGTTTATGTCTGTGCGTGT
AGAAGTGGCTGCTATCAGTTCTGGATTCAACGAAGCCTTC
TCAAAGCCAATCATATGTCATGAATCCTTCTAAAGCAATA
CATGTTATCAATAAGAGACTGAAGATTAATTATCAAATAT
GTTGAAGTGACGTCATGATTATCATGACATTTCTGTGAGG
TTTACTCTACTTCAGGCACCTTCATTGTTTTATTAAAATG
TAGTTTAGTTTCATTACATTGTAAGGATGTAAATCCTGCT
GGTATATTGTTGTTGTTGTTTTCATCAGTTTCCACAATAA
CACTGAACTCACTGAAGAAATACTGTCTAAATGGCAAGAC
CGAAGCTACTGACGTTTTTTTCCAAGGCACTGAGAGTAAA
GACTGGTATCAAGGGTTACTTTTGGGATTGTTGAGGGACC
AATATTAAGAGTGCATTAGGTATTTAAATGTTTACTGCAG
TACTTTGGTGTTTGATTGACATGTAATTTGTACAGTAAGA
GATTACAGGGTTATGTGATATTTTATCTGTGACCAGTCAG
AAATTTTGACACACCAACTCAGTCTTCGTTATTTTTATTT
TTTACTTGTGACAATGTTAACGTGATCAAAGTATCTAAAA
CTGCAGTCAAAACATTTTATACAAGCAAAAAACTTGTATC
TGTGCTACTTAAAAATCTTTTAATATCCACTCCAACGTGG
CCATACATACTAATACAATAATTTAAATTATAACAATGCA
TACAAAAACCAATTTCAAGTATTCACAGAGTAGACTTTAG
CATAGAAGGGTTTCTGATCACGAAAAAAATAAAGTCGTTC
TAGTGTGTCCAAGCTTTTGACTGGTTGTGTTTGTTTTACT
TTTTTGAAAGAAGTTTGTGTGTAATTGGTTCATAAACAAG
TGTTACTTTTTCCAGGATAGGTAAAGATTTAAAATGTTGG
TCCTTCTACAGTTTTGCTGTATTGCAATGGTGTGGAAATG
TTTTGTTTCCCTCTTTTAAGGAACGTCTGTGAAAAGCAAA
ACCCATTTAGAATCGACATGATAGTAACGCACATCTGAAT
GGAGATTATCTGAGAACTTGGCATAGCTGAGTATTTGTGG
AGTTCAATGCTTTCCCCTTTTTGTGTGGTGTTCATGGGTG
TAGTAACTCCTGGATTTGTGTTGTGTTCAGTTTTCTGATT
CGCATTTGCTCCAAGCCACTTTCATTGGTTGTGTATATTT
AGTGCACTGTTTAATTTACGATAATAATATTGTAATTAAA
AAAATAGGTTATTATAAATGGTATTTGGATTTGTAAATAT
CTGGTCAATAAATATGTTTTATAAA

gdpd1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gdpd1-201 2665
gdpd1-202 (1)    Ensembl 523
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gdpd1-201 Contained in:
[BAC] CH211-214G1 (1)

Genome Resources: Vega_Trans:OTTDART00000026052 (1),  Ensembl_Trans:ENSDART00000049196 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC080230 (1) 2545 nt
GenBank:AW280712 (1) 617 nt
CITATIONS (2)