Transcript

nxn-201

ID
ZDB-TSCRIPT-090929-8744
Name
nxn-201
Previous Names
  • nxn-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026049 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026049|OTTDARG00000020730|ZDB-GENE-050522-75 nxn|OTTDARP00000021398 nxn-001 LG_none AL954372.6,CR848831.6 Danio rerio protein_coding KNOWN, 2478 bp
GTACGTGCAATGGCAGCATGTGTCCACTAGATGTAGCGAG
AGCCTCGCAGCGGGAGTCTGCAGTCGCTGTCGCCGAGGGC
CGGTCTCTATGAGCGGAGCAGCGCATTCCTGAACACCGCT
CAGTGGAGACGTTCGACGGCCGTTGCCTCTGCGCTCGAAC
CCGCGCCGCTTACAAACCGGACACACGGGCCTCGGGATAT
CCACCTGGCTTCAGTTCTTACCCGCCGAATAAGCGAACAA
AAGCACAAGGAGTCGGTTTCGAGGGCTCAGTAGCGATGTC
GGAGTTTCTGGTGAATCTGCTCGGAGAGCGGCTCGTCAAC
GGGGAGAAAGCCGAGGTGGATGTGCAGGCGCTGGGCAGCA
GGCTGTCTCTGCTCGGGCTTTACTTCGGCTGCAGTTTAAA
CGGCCCCTGCAAGCAGTTCAACGCCAGTCTGACCGAGTTT
TACAGCAAGTTTAAGAAATCCTCCGAGCACAAGGACAAAT
TGGAAATCGTCTTCATCTCTTCGGATCAGGACCAGAAACA
GTGGCAGGACTTCTTGCAGGAGATGCAATGGCCGGCGTTG
CCTTTTAAAGACAGACACAAAAAGATGAAGTTATGGAACA
AGTACAAGGTGACCAGCATTCCCTCTCTGGTGTTCATCGA
CGCTGCCACGGGGAAGGTGGTGTGTCGAAATGGATTGCTC
GTAGTGAGGGATGACCCAAAAGGCCTGGAGTTCCCCTGGG
GGCCGAAGCCTTTTGCGGAGGTGGTGTCCGGGCCCTTACT
CAGGAATAACCGACAGACCACAGACAGCACTGCCCTGGAG
GGATCCTATGTGGGGGTTTACTTCTCTGCACACTGGTGTC
CACCTTGTCGCAGTCTAACCCGAGTGTTGGTGGAGTCGTA
CCGTAAAGTAAAAGAAACAGGGCAGAAATTTGAGATTGTG
TTCGTCAGTGCAGATAGGTCGGAGGAGTCGTTTACTCAGT
ATTTCAGCGAGATGCCATGGTTAGCTGTGCCGTACTCAGA
CGAGGCCAGACGATCAAGACTCAACAGACTCTATGGCATC
CAAGGTATCCCTACACTGATTTTGCTGGACACAGAGGGCC
ACATGATCACGCGGCAGGGACGGGTGGAGATTCTCAATGA
CCCCGACTGTGGGCTCTTCCCATGGCACCCGCGGCCTGTA
CTGGAGCTTAGCGAGTCCAATGCTGTGCAGCTTCATGAAG
GACCCTGCCTGGTGCTGTTCGTAGATGCTGAGGAGGAAGG
AGAGCTGGATCCGGCCAAAGAGCTCATCCAGCCAATCGCA
GAAAAGATCATGGCTAAATACAAAGCCAAGGAGGAGGAGA
CGCCACTGCTCTTTTTTGTAGCTGGAGAGGATGATATGAG
CGATTCCCTGCGGGACTACACTAACCTGCCTGAGGCTGCA
CCTCTCCTCACCATCCTGGACATGTCGGCTCGCGCCAAAT
ACGTTAAAGATGTTGAAGAGATCACACCGGCTGTGGTAGA
ACAGTTTGTTAGTGACTTTCTAGCAGAAAAGCTCAAGCCA
GAGCCCATCTGAAGTCCTGGACTGCACTAAACCCTCCCAC
AGCCGTTACCCGAACCTCCATCTGGCCCTTGGCCTCCAGG
CGTGCACTCTCTTCTCTTCCTGTCAGACTGTTTGAACAGA
AGCATACTTTGTATTGACATTTTACTTCTTTTTAAACGTG
CCCCTCCATCACGAAGCGGCCGCCTCTTCCTGTGGTGCCT
TGCATTTACTACAGCGCTGATGGTCAAATGCAGATCTCTA
CGTTGATTGTCTTTGCCATAACATTTAGATTAGATCGAAC
CCTGCAGCTCCAAGTGAATACCTTTTTTTTTTCATCAAGT
ATTTTCTTCTATCCTTGGATATTGTTTTAAGAATCAAGAG
CTTAGAATAATTATAGCTTGGTAGATGTATTATTTTTCCA
CAGACACTGCACATTTTCCATTGTGTATGTACGGCCGTGA
TTCTCTTATGGGTGCTGATAAATATGCGTACATGCTGATG
TTGATATCATTGTATAGAAGGCACTATCTATTCTTTGTGT
AGCTGCCGCTGTTTATTTTCAATGCAGTTGTCTGGAATCT
GCCCACCTCCGTGTTTGATATTTGATGTTGTCGGATGACT
GATCTGTTCCCTACTCAAACATGACATTTTAGTGGATTTT
CTGTGAAGGTCCCCTGTATTAATGCAGTCTTATGTTTTTG
AAGGCACAATAAACAGCATCTAATAGCAAGCTTCCCTTAT
GAAATGTAGCCAATTAAAGCACACTGTCTGTTCTTGGTTG
TGTTTGAACTGATGTCATAGCCATTAAAAGTCACTGTTGA
AAATGTGTTTCTCTTAATGGTGCTTACAATGGACACACAC
TTGCTAAACAGTTTCTGTAGATGCATTCAGTATCTTCATT
TGCAGAAAATTTAGTCAATTCAATCATTTTAATACAAATA
TAGTAATAATTTGAATAGTTACTGATCCAGTGTTGTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations