ZFIN ID: ZDB-TSCRIPT-090929-8726
Transcript Name: zic2a-201
Previous Name: zic2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026030 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026030|OTTDARG00000020717|ZDB-GENE-000710-4 zic2a|OTTDARP00000021382 zic2a-001 LG_ BX469902.7 Danio rerio protein_coding KNOWN, 3177 bp
GGACCCTCCGAGATAAACATAGACAAGCGAAAGAAATAAA
CATTCCAATTCGAGATGCTTCAAGAACCAGGAAGGCTCAG
TAAGATATTGACTCGTATTTTCGTGTAATCCGCAAACAAC
GACATCGACTCAGTTTGAAAGGAAAAACGCAAAGGAATCT
TTTCATTTCGTTGCATTGGGGATTTTGAGTAACAAGTTAT
CCGCAAGAAAAATATAGTCTAACTTAATACGCAAAGCTTT
TTTTTCGCCCTGTGAGCGGGGATTGAACTTCATCGCCTCA
TGTCGTGTTGTCAAACCTGGAAGTTAATATTACCGTAGCG
CATTTTATTTTATTTCATTTTCTTAAATGTTTTGTTGAAG
CGCCGTGAATAGACTGCTTGAAAGAGAATTGGTTTTGCGC
AACGAAAACATGTTACTGGACGCAGGGCATCAGTTCCCTG
GTTTGGGAGTGGGCACCTTTGCCAGACATCATCACTCCTC
TAGTGAGATGCAGGACAGAGACTTGAGTTTAGCGCAAAAC
AGCTTCGTCGACTCGGCGCACATGGGCGCCTTCAAACTGA
ACCACGATCTCTCGCCCGGACAGAGTTCTGCATTCACGAG
CCAAGCGCCCGGTTACCCCGCTGCGGCTCTGGGTGCGCAC
GCGGCTCATGTCACATCATATGCGAGCTCGCCGTTTAACT
CCACGCGGGACTTTCTCTTTCGCAGCCGTGGATTCGGGGA
ATCATCACCGGCAGGAGGCCAGCACGCACTCTTCGGCCCC
ACTGCCGGCTCGCTCCATCATTCTCACACAGACAGCCAAG
GCCACATTCTGTTCCCTGGCATTCACGAACAGCATGGATC
TCACGGCTCCCCAAATGTGCTCAATGGGCAGATGCGACTC
GGACTACCAGGGGAGGTTTTCGGGCGATCAGACCAGTACC
ACCAGGTCTCTAGTCCGAGAACCGATCCTTACTCGGCCGC
CCAGCTGCACAACCAGTACGGCTCCATGAATATGAACATG
GGGATGAATATGGCAGCGCATCACCATCACCCCGGTGCCT
TCTTTCGCTACATGAGGCAGCAGTGCATTAAGCAAGAGCT
CATCTGTAAGTGGATCGATCCGGAGCAGCTCAGCAACCCT
AAGAAGAGTTGCAATAAAACTTTCAGCACCATGCACGAGC
TGGTCACCCACGTCTCTGTCGAGCACGTTGGAGGACCCGA
ACAGAGCAACCATATCTGCTTTTGGGAAGAGTGTCCGCGG
GAAAGCAAACCATTTAAAGCCAAATATAAACTGGTCAATC
ACATCCGCGTGCATACGGGAGAAAAACCTTTCCCCTGCCC
GTTCCCTGGATGTGGCAAAGTCTTTGCAAGATCAGAAAAC
CTTAAGATACACAAAAGAACACACACAGGTGAGAAACCAT
TTCAGTGTGAGTTTGAGGGATGTGATCGACGCTTTGCGAA
CAGCAGCGACCGAAAGAAGCATATGCACGTCCACACGTCA
GACAAACCATATCTCTGCAAAATGTGTGACAAGTCCTACA
CTCACCCCAGCTCTCTTCGAAAGCATATGAAGGTACACGA
GTCATCCCCACCTGCATCCGACTCGTCGCCAGCGGCAAGT
TCTGGTTATGAGTCCTCAACACCCCCTGGTCTGGTGTCTC
CCTCCACTGAGACCCAAAGCAACAACAATCTGTCGCCTTC
CTCAGCGGTCCACAGTTCCAACAACCACAGCAGTTTATCG
TCTAATTTCAGTGAATGGTATGTTTAAGACTGTGCCATCC
CAGGAGGACCCGATAAAGAAAAACAGGAGATCCATATACA
GCTTGTACAGAACGAACGCTTGAATATTACGCTCTTGTCC
AGCAGGATATAACATTCCTACATCGACAGAAGAAACGTGC
GCAAACGCACCAAACATCTCTTTTTTTGTACATACTACGC
GCTCTCTTTCCTAATGGTTGTTATAGATTTTGTCGGTTTT
TGGTGTATAGATGTTCCTTCAATGGTAGCTATTTCTCTAA
CTGGACTTTTTAGTGCACATATTACCATAAAGTTGTATTA
TCATAATGAATATTGTGATCCCATTAAGGCAAACTGATTG
TAAACTAAACAACTATTAACTGGAAAGAGTGCCAAAGTCA
ACATTTAACGAAGAAAGACACAATATTTGCTTGTGAATGT
ATATCTTAGTTTGCTGGGCTTAACTTGTGATGTTTTGTGC
TTTGCAAGTTTGAATTGTGAAATATATTTGGAAGATTGTG
GGGCAAATTAATGTCGTGCGGTTAAATATCTGTAACTACA
CCCTTCTTTTTGTAAATATCGACTGCCATATTTATCCATT
TGTAATTAAATTATGGTATTTACTTACTACAGATGAAACA
ATATTTATAAAGAATGTTTCTTTACTATAAATATGTACAA
TAATGGGCTAAACAGGGGCATTTGTTTTGTTATATGTGTT
TTTGTTTAAAGTTTGAGAAGTGTTTTCTCCATTATTGTGA
TAAAATTTTACTGCATACAGATATAATAAAACGTGGTGCA
AGTGTACAATCTTTACAACGCGTCGTGTTCATTCCATGTT
ATCACTTGTATTTGTTAGTGAACTTTGACAACTTTTAGGC
TTTAATGTTATTAACACTATAAATTATCTTTAAACTAAAC
TTCTGGCAGTTATCTCAAAGCTAGATAAGCAGATAGCGCT
GAATTATCTCTCCATTAACAATTCGGCGTTTCAAACTCAT
ATCTGTAGAACTGACTTGAATGTTTTAGCATTTTAAAAGA
AAAAAAAGTACATGCGTTTTTCAGTGAGCAAAAACATCAT
GTAAACTGTAAACTAGGAGTTTATAGCCATAATATAAATA
AGTTATTAATAAGTAGCCTATTTTCTTTACTAATAAAGTA
AGATTTTATTTTTTGATTTAACTTTGGATAATGCCATATC
CTTTCACGCTTAAATAAAGTTAAATAGAGTTTAAAATCAA
GTGGCCGTGAACTTGAACTTGACTCTGGCACTCTTGTAAA
GCTCTGAAAAAAGAAACATTTTCCCGCAAAACTAAGAGCT
GTCAGTTTCTGCAACTTGTTCGCTCAATTGTGAGTCGGAT
TTTAGTCTTTCATAATCGTCTAGATACAGCAACATTCAGC
CGAGAGCCAAAAACGCGGAATTAAATAAAAGGCATTTGAC
ATTGTGCCGAGACATCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zic2a-201 Contained in:
OTHER zic2a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026030 (1)
  • Ensembl_Trans:ENSDART00000010774 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF151535 (1) 3132bp
    GenBank:BC065635 (1) 2580bp
    CITATIONS (2)