Transcript

timm50-201

ID
ZDB-TSCRIPT-090929-8683
Name
timm50-201
Previous Names
  • timm50-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025984 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025984|OTTDARG00000020695|ZDB-GENE-040426-1618 timm50|OTTDARP00000021346 timm50-001 LG_none CR626887.6,CR853297.8 Danio rerio protein_coding KNOWN, 1807 bp
GCGCTCCGGGTACGAACTGCATCATATTCAAGATGTCGGC
GGTGTCTGTGTATCCCATGTGTGTCCGGGCGAGCCGGGGC
CTGCTCAGACTGAGGCAGGGGGCCCGCTGCTCCACGGCCC
CTCCGCTGCTGGATGTCGTCCGGCCTTTATCCGCTGACAC
GTCCAGTAGCAGCGCAACAGGGGGACTGGCACAGGCGATA
CTGCAGGAAAGGCTTCAGCAGCAGCAGAAGAGCCAGGAAC
AGCCTCCTCCAGAGGGTGAAGACTCTGGCCACAAGCAAGA
TGAGCAGGGCGAGGACAAGAAACAGAAAGAGAACACTGCA
TACGCCAAGAAGATGGTCCTTCGGTTAGCAGGAATTATGG
GACTTGGAGGCACAGTTGGCATTGTATATATATTTGGCAG
CAATTCTGTGGATGAACAAGGAAATAAGATTCCAGATGAG
TTTGATAATGATGTTCCTGTCATCCAGCAGCTTAGAAGAA
CCTTTAAATATTTCAAAGATTACAGACAGATGATCATCGA
GCCCACAAGCCCAAAGCTTCTTCCAGACCCTCTACGAGAG
CCTTATTACCAGCCTCCATATACTCTGGTGCTGGAGCTCA
CAGATGTCCTTCTCCATCCAGAGTGGTCGTTGGCCACAGG
TTGGCGTTTTAAGAAGAGGCCTGGCATCGACTACTTGTTT
CAGCAATTGGCGCCACTTTATGAGATAGTCATCTTCACAT
CAGAGACAGGCATGACAGCATACCCCTTGATCGACAGCAT
AGACCCTCAAGGATTCGTGATGTACCGACTCTTCAGGGAT
GCCACACGTTACATGGAAGGCCACCATGTTAAGGACGTGT
CTTGTTTGAACAGAGACACCTCTAAAGTCATCGTGGTGGA
CTGTAAGCGGGAGGCTTTCGGTCTGCAGCCCTTCAACGGT
TTGGCGCTGTGCAAGTGGGATGGAAACTCAGAGGATCGCA
CTCTGTATGACCTGGCTGCTTTCCTTAAAACTATTGCCAT
CAGCGGGGTGGAGGATGTGCGTTCAGTATTAGAGAACTAC
GCCCATGAGGAAGACCCTATTGAAGCTTTCAAAAGAAGAC
AGGCACAGCTTGCACAGGAAGAAGAACAGAGAATTTCAGA
AATGGCGCAACAGAAGAAACAGGGCTTTTCATTAGGCACC
ATTGCAGGTCGTTTCTGGTCCCGAAAGCAGCAGTGAAGAC
TCGTCCTGCTCGCACCACCCGAAACCACCCCGTCTGGACT
GTGAGCAGCCATTAAGATGAGGGTCACAGTCGAACAGGAG
GACGGTGTAAGTGGGCACACAATGGCATGTGTGGAGAAAC
ATCCAATCGGGCTATGCTGAACAGGATTTTAGGGGTTGGA
AAAGGAGTGACCAACTCTAAAAAGACATTCATTCCTGTGA
AAGATGGCACTACCTGGACAGAACATGCACATATGATGCT
CTTATGTATGATCTCACTGATTAGAAAGGGTTTTGGGGTG
GTTGGACCAGTCTCCACAAGAGTAAAAATCACAAACTGAA
GAACCGATCATATGTTCATCACGTTGGTCCCATTTGAAAC
CCGTAACGGATGCTGTAGGCCTGTAATAGCCTGATATTAG
ACTTCAATGTTTGACTGGCACATGAAGCAAAACCTCGCAT
TTATGTTGGTGCTGCCAGTGAGTCTGATAAAGCGAGCTCA
ATCTGGTGCTGTTTCTCTTCATGTCAGAAATGGACCGTCT
TGTCTGAGGATGTGCTTGTGGAATGTTCTTTGTATTGCTT
TTGTTGTGAAACACCCAGAATATCTCCAATAAATAAACTA
TAACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations