Transcript

dlc-201

ID
ZDB-TSCRIPT-090929-8661
Name
dlc-201
Previous Names
  • dlc-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025961 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025961|OTTDARG00000020683|ZDB-GENE-000125-4 dlc|OTTDARP00000021328 dlc-001 LG_ CR626887.6 Danio rerio protein_coding KNOWN, 3567 bp
AAGAAACGTAACTGAAGGGTCCAAAGTCCCCTGGAGCTAG
AAATCTGTTTTTATTTGCTTTGTAGGCTCCAAACACATGC
GACATTGAGATACTTTTTTATAAGAAATGTTCATTCGTTT
AACTTTTTAACTTTACGCATTTTTACAACTACTTTTCCCC
TTTAAATCGTGGATAATACTACAAACATTCATATCGGACT
ACTCTCACAGTCTGCTATCGTTCAGTAGCAGACAAGAAGG
CAAAGATGGCTCGTGTTTTATTAACGTGCTTTTTTATTTT
GATATCATCGCATTTGGGGAAATCATCCGGTGTGTTTGAG
TTGAAAGTTCTGTCTTTCACAAGCACGAGCAGTGTGTGTA
AAGGGTCCAGCGACTGCCAGATCTTTTTCCGTGTTTGCCT
GAAGCACTCGCAAGCACTCATATTACCTGAGCCGCCGTGC
ACCTACGGCACCGGAATGTCAGAAATACTGAGCGCGGACT
CCATCTCCAGCAGTGCGTATATAAGCGTGCCTTTTAATTT
CAAGTGGCCGGGAATCGTCTCTTTGATAATCGAAACCTGG
AACGCAGAAACCTCTGACCAGTCAACAGAGAATAACAACA
ACATGATAAGCCGTTTGGCCACCAAAAGAAGACTCGCTAT
CGGTGAGGACTGGTCTCAGGACGTGCATCTCGGTGAGCAA
AGCCAACTGCGCTTTTCTTATCGTGTCGTGTGCGATGAAT
TCTACCACGGCGAGGAATGCTCGGATTTCTGCCGCCCACG
GAATGATACCTTCGGCCACTTCAACTGTGACGCCGCTGGC
AACAGAATTTGCCTTCCTGGATGGAAAGGCGATTATTGCA
CCGAACCCATCTGCTTGTCTGGCTGTAGTGAGGAGAACGG
TTATTGTGAGGCCCCCGGTGAGTGCAAGTGCCGGATTGGA
TGGGAAGGCCCCCTCTGTGATGAGTGCACGCGGCACCCGG
GGTGCTTGCATGGCACCTGCAACCAGCCTTTTCAGTGCAC
TTGCAAAGAAGGTTGGGGCGGTCTATTTTGCAATGAGGAT
CTGAACTTTTGCACTAATCACAAGCCCTGTAGAAATGACG
CCACGTGTACCAACACCGGCCAGGGCAGCTACACCTGCAT
TTGCAAGCCTGGCTTCAGTGGCAAAAACTGTGAGATCGAA
ACCAATGAGTGTGACAGCAACCCCTGCAAGAATGGAGGCA
GTTGCAATGACCAGGAGAATGATTACACTTGTACATGCCC
GCAAGGCTTCTATGGCAAGAACTGCGAGGTCAGCGCCATG
ACCTGTGCCGATGGACCCTGCTTCAATGGTGGAACCTGCA
TGGAGAAGGGATCCGGTAGCTATTCCTGCCGCTGCCCTCC
TGGATACATGGGCTCCAACTGTGAGAAGAAAATCGACCGG
TGCAGCAGTGACCCCTGTGCTAACGGTGGCCAGTGTCTCG
ATTTGGGCAACAAAGCGACGTGCCGTTGCCGGCCCGGGTT
CACAGGCTCACGTTGTGAAACAAACATTGACGACTGCTCA
AGCAACCCCTGTCAAAATGCAGGCACCTGCGTGGATGGTA
TCAACGGGTACACCTGCACATGCACGCTTGGTTTCTCAGG
CAAGGACTGTAGGGTTCGCTCTGACGCCTGCAGTTTCATG
CCCTGCCAGAACGGAGGAACCTGCTACACTCACTTCTCTG
GGCCTGTCTGCCAGTGCCCGGCAGGCTTCATGGGCACACA
GTGCGAGTACAAACAGAAGCCCACGCCTGTGAACAGCCCT
GCTCTTCCAGCAGCCTTAATAGTCTCATTTACTCTAGGCC
TCATTACTCTAACCTTAGTGATCTGTGCTGCCATTGTGGT
CCTGCGACAGATGCGTCAGAACCACAAAGCCAGCTCAACC
ACAGTTCGAAACAACCTGGATTCTGTCAATAATCGCATTT
CTTTGAGCCCAACCTCCACTTTAGGTAGAGAGAAGGAGGC
CTTCCTTATTCCTGGTGGCCCATTTAAGGTGTCCAATAAA
GATATGGCGCTCAGATCCACCTCTGTAGACACACATTCCA
GTGACAAATCAAACTATAAGCAGAAGATGGTGGACTACAA
TCTGAGCATTGATGAAAAGCACACAAACAACAAACTAGAG
AAAAACTCTGAATCAACATTGCTGGTTCCACCTTTAAACT
ATCCAAAAGAGGGAGTGTATCATCCTGTGTACATCATTCC
CGAACACATAGAACAACGTGTGTTTGCTACTGAGGTATAG
CAGAATTCTTCAATCTGGAGCACCTCAAACACCAGTGGGC
CTGACCACAAAAATGTTTACAGTCTCTAAGGACAAAAGGA
AGACGTGAAGAGAGTATATATCACATGCATTATATTATTT
ATTTATTCATGCTGCTCACTAAATGGACTACTTCTTGATA
TGGATAATGAATTTGTGAAGACAAGCAAGAGACTTGAAGA
CCCGTGGAACAACTTGCATTATTTGCACTATTTCCTTTCC
CTTTTTTAATGACCCAAACAGAATTTTTATATATTTGTCA
TCATATTTAAATTGTACATAGACACAAGAACTCTCTGGAA
GAGCTGAAGAATCAAGGATTTGATAATCACAGAAGCCTTG
AAAAGGAAGAAAATAGGCATCCTGAAGTTCATCTAACTCT
CTGAATCACATGGAGCCCAAACAATCAGCCTTATGGGTGG
AGGAGGTGCAACTGAAGGATCTGGAACTGTGACTGTGGAG
TATTTGCCTTTTATTTTTATTTTTTCGATATGGTTCGAAA
TGCTATTTATAAATGGAACTGTGATGAGAAGCAATCAAAC
TGAACAAAACAAGTTGTTCTGGCTGTGAACAATGTGAACA
ACTGTCTTGGAAATGTACAGTTTTATGCGGCAGTGATTTT
ACTTAGTGCCTACAATGGATCTGACTATCAGTGACATTTT
CTCAAACCAAACCCAATCTCAATTAAGTGCCTCATTCTTT
AATGTGCTACAGCTCAGTTACAAAGGTACTCCTTAGAAAC
ACTGAAAAGAGCCTTTTTTTAAACACTATAGGAGTATGCT
TTTCGACAGTAGATGTTTGGGTTGATTTGAGTACAGTTGT
TTAAACAGCGATGGATGATGGATGCTGTTGTGTACAGCGG
CCATCCTGTCAACATTCACTGCTGGTAATCTATTTCCGAC
ATTCCCAAGGCTTGAAAGGACCCTTGGTCCAAACTGATAG
CCTCAACATTGTCAAGATTTCCTGGTTTTGTAATCCTCTG
CAATCAGAGTGTTTTTCAAAATTCGCAACAACATAGATTG
TTCTATGTCTTTTCCTTTCCTATTTTATTTTTTATTTTTT
AGTATGTGGCATTTGTTCCGTCATCTTCATTTTTTAAAAC
CATTTAAACCAAAATAGATGATACTTTTATATTTTATACC
GTCTTCCTTAATTTAACAATGCAATAATGTACAAAATCTT
GAGATAATCCACTATTTAATTGGACTGTAAATATTTTGTA
TTTATGAGAGATGAATGTATATATGTTTATGTATTTTGCA
AATATATATATATATTTTTTCATATAAATAAACCCCCGAA
TAATTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations