Transcript

esco2-201

ID
ZDB-TSCRIPT-090929-865
Name
esco2-201
Previous Names
  • esco2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000006888 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006888|OTTDARG00000006251|ZDB-GENE-050913-156 esco2|OTTDARP00000006125 esco2-001 LG_ AL845306.9 Danio rerio protein_coding KNOWN, 2339 bp
CTTCCGTGTGCGCCACAATTGACTTTGGCGCGTTCTTCAA
AACAGACCGCGGGTGAAGCTGAGAGGATTTGCCGCGGTTA
TTTTGCTCCAGTGTTTTCACGTAAATTCAAAACCAGATTT
GGTACTATTCTACCCGGTGATTGAAGATGTTATCCCGAAA
GAGAAAACATGGCTCTCCTGATGCCGAGAGTAATCCATCG
AAGAAACAAATAACAAGCCTGAGGAGTTCTCCAAGAAGGA
CCACTCGACAAAAAGAAAACATTCCCATTTCTCTGAATTC
CCCCCAAAAGATTCCCAGCACACCTAAAAAGACGCAGAGG
GCCTTTTTGCTAGAATCTCCCCCAAAGCGAGTCTCGCCAC
GGAAAGCAGTGCTGGGAGCAGGGACCTTCTACAGCAAGCA
GAAACCCCTGTATCTCACACCTCTGGAGAGAAAAGTGCTG
AAAGAAGCCAAATCTCCACCATCAGTCACTAACAAAGAGC
CGTCACGCCCTCCTTTGACTGCTGCGAATCAGGTTGTAAA
ACCAGCCAAGAAAGTTCAGAAGAAACCCAGAGCTTCTGCT
CCACAGTCCAACCTAAAAGGCTACTTCACGGCTAAGCCCA
AAGCGACAAAAAGTTCGTCAGATAAACAAACGGATCAAGT
GCTGAAATCCACAATGGCTCCCATTTCATTCAGCAGTATG
AAGTCCAAAGGTAAACCCAAGCTGGTTGTCGGCGCTGCTT
TCTTCAACACTGGAAAAAAGCCTACTTCAATGTATAAGAA
GTCTGCACAGAATACAAAACCTAAACCAACATACGAAAAA
CCCAGCATTCGGAAACCGGTGAGGGAGAAGGAATTGGTGA
CGGCACCAGGACAGCGTTCCCCAGTTCGCCGTGCTGTTTT
CTTGAAAAAACAGCCAGAAGTGGAAGTTAGCCATGATAAA
AGAGAGTCGACACAAGCGCCAATGTCTCCTCAGGTCCTTG
CAGATGTGCATGGCATCACTAAAGAGCTGAGGGTGGTTTT
GAGGAGATCTGTGAGCCCTGAGACTGGCAGCCAGGACGCT
CCTTCTGAAGCTGATTCGGTGTTTGATGTGAGTGATTTAC
TGCTTCCAGATCATGATAGCTCTCATGATGAAGAAGAGTC
ATCTGTGTATCCCATCTTTGGCACTAAAAGACCTCAGAAA
AAGGGGAAGTTGTCTCCACCGCTGAACAGCAGCACTCCTT
CAGCTCTGACCGCAACTCCTGCTCTTAAAGCCAAAGAGAG
GAGCATGCTGAGGAGAGAGATGAAGAAGCAAACCGACAAC
CAGCTCATCATCGATGCTGGTCAGAAGCAGTTTGGAGCCA
CTACCTGTGCATCCTGTGGGATGCTGTACAGCACAGACAG
TCCAGAGGACAACTTTCAACACACACAGTTCCATCAGCGC
TTTCTGGACACCATTAAGTTTGTGGGCTGGAAAAAAGAGA
GGGTTGTGGCAGAATTCTGGGATGGAAAGATCATTCTCGT
TCTTCCAGATGATCCCAAGTACGCCACGAGAAAGGCAGAG
GACGTGAGGCGGATTGCAGACAGTGAGCTGGGTTTTCAGC
AGATCACCCTCAGCAGCCCGAGCTCTGCTAAAACATACCT
CTTCATCAACACTGACAGGATGGTTGTAGGATGTCTGGTG
GCTGAGAATATTAGACAGGCCTATCGTGTGCTGGAGCAGC
AAGAGAAACAAAAAGACATGAGCAAGGAGGACTTCATGGA
GCACCACAGGACCTGGTGCTGCTCTACTGTCCCGGAGAAA
GCCCTCTGTGGCGTCAGTCGCATCTGGGTCTTCAGTCTGA
TGAGGAGGAAGAGCGTTGCCACACGCCTTCTGGACACGGC
CAGGAATACGTTCATGTACGGAAGTCACCTGACCAAAGAG
GAAATAGCCTTTTCTGACCCGACGCCACAAGGGAAGCTGT
TTGCTACAAAGTACTGCCAAACACCAACATTTCTGGTGTA
CAACTTCATCAGCTAAAGAAAAGAATCCAGTCTTAGTTTG
TTTGACTGCATTTATTAATGCATGTGAGAGTTTTTAAATA
GAGAAAGCAGTGTTAGGTGTTTAAGTCAAGTTCAGTTTAA
TCAATGTTCCAGAGAAAATCAGTTTTTACTGTGAAGTTTT
ACTTGTTGAGACTGATGTTTTACCTTGAGTTCATGTTTCA
GGCAGAGTTTTACTTCAGCACGATTATTGAATCAGTTCAT
TATGAGCTAGCAGGTCCTCAAGGTCTCTGTTTGGAAAACC
AGGCTGCTGTGATTAATTACATTTGTAAAGTGAACACTTT
TCGTTAAACTGCCCTTATAGACTGTATATATTTTAAAATA
AATGTTCTTGCTCACTTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations