ZFIN ID: ZDB-TSCRIPT-090929-8646
Transcript Name: cldne-201
Previous Name: cldne-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025946 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025946|OTTDARG00000020672|ZDB-GENE-010328-5 cldne|OTTDARP00000021316 cldne-001 LG_ CR382327.27 Danio rerio protein_coding KNOWN, 2083 bp
CTGCAAACACAGCCGAGGAATCCGGTCAATCTTGAAAATT
CACCTCCAACCCAGTTTCATCAGCCTGGAACTCCTCCCAT
TCTGGACACAATCTTAAAACTCTGTAAGCCTGTGCAGTGA
AGTCACTACAACCCTTCGGAGCGGACAGAAAACACACGTT
CAACTTCACAAGCCCACAAACAAACAAGCAAACATGGTGT
CTATGTGCCGAGAGATCCTGGGCATGTGCCTGGCCATCAT
TGGCTTCTTGGGAGCCATTATTATTTGTGCTTTGCCCATG
TGGAAGGTGACCGCGTTCATCGGAGCCAACATCGTGACGG
CGCAGACCATCTGGGAGGGTTTGTGGATGAACTGTGTGAT
GCAGAGCACGGGACAGATGCAGTGTAAGATCTACGACTCG
CTCCTGGCCTTGCCTCAGGACCTGCAGGCCGCTCGAGCTC
TCGTGGTCATCGCCATCATCGTCAGCTTTTTCGCGCTCAT
CCTGGGCATCGCCGGCGGGAAATGCACCAACTTCGTGGAA
AGGGAAGACGCCAAGGCTAAAGTGTCCATCGCCAGCGGCG
TGATCTTCATCATTGCTGGAGTTCTGGTGCTGGTGCCTGT
TTGCTGGTCCGCCAACACCATCATCAGAGATTTCTACAAT
CCTCTGCTCACTGATGCTCAGCGGAGGGAGATGGGGGCTT
CGCTGTACATCGGATGGGGCGTCGCAGCGCTGCTGATCAT
CGGAGGTGGAATCCTGTGCAGCTCCTGCCCTCCAAAAGAT
GAAAAATACAACATGAAATACTCCCAGCCGCGCTCCACCG
CCACCAGCAGAGCCTACGTCTGAGAGCTACGCGGAGATCG
CAAAGACTTTTGGAGACTCTCTCTCACTCTTTCGTTCTAA
GACTTGCCAAGAAGATCAATTGAAAGACTGTGTCTGATAT
TGCATATATAGTGGTTATATAGTGAGGATGTATATATGTG
CTGTGATTATACACACTTTTGAGCTGAATGAACACAACTC
CTGAGATTTCTGTTGGCACAACTTAACTGTTTCATGTCAA
ATTCACTTAACGGCTAATAACTTAATCGATTTGTGTTGTG
CCGACGTGAATGAACTGCGTGGAAGCCTGCATTTGTTTTA
CAGCGTGCACTCAAGAAAATGATGTTTGCAGATGTTTTGG
AAAATAATGCTTGCCGTTTGTTCAAACTACTCATTTGAAA
TGAGCTGAAACAACACAATTCTTGAGTTTCTTTGGGACAA
CCTAATTGTTTTATGCTCAATTCAATTAAAATTGTTAAAA
AATAATAAGCTTACTTAATTTATTGATGTTCCACCATGAA
AAATTGACTAAATAAATTTGATTGTTGGTGGTTCATTCCA
CTGTGGCGACCCTGGATTGATAAAATTATTTTAAAAAATA
ATTAGCTAACGTAATTCATTGATGTTCCACCAACAAAATT
TTGGCTAAATAAACTTATTTGTTGGCGGTTCATTCCACTG
TGGTGACCCTGGATTAATAAAGTTATAAAAAATTTAAAAA
ATAGCTAACTTAATTCCTTGGTGTTCCACCATCAAAAATT
GACTAAATAAACTTAATACTCGGTGGTTGATTCCATTGTG
GCGAATAAAATTATAAAAAACATATTAAGCTATTTTAATT
CCTTGATGTTTTCCCAACATAATTTGATTAAGTTAACTTA
GTTGAGTGAATTCAACATAAAACAATTAAGTTTTCCCTCC
AAAAAACTCAAGCTAATTTTAAATAAGTAGTTTGAAGAAG
GCATTTATTGAGTGCAGATCCCTGAAAGAGAAAAATGTGC
ATTTATAATGTGATTTTATTCAATATTTTTTGTTGATTTT
TAGTTTTTTTTTAACAATGCATTCTTATATTATACGTTTA
ATATGACGAGAGGAATAGTTTCTTTAAATGTAAGACGTAA
GCTTTAATACTGTAAAGATTAAATGTGCATTAACTTAGCT
TTTGTGTTTGTTTGTCAGTGTATAAATTAACTTTTTTTTT
TTGCATAAAGATGTCTTAATCAGTAAAATTGTCCTGATAT
TTGTTTTTGTTTATTATAATAAATGGTTCTGTAAAACTGT
AAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cldne-201 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000025946 (1),  Ensembl_Trans:ENSDART00000063320 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF359425 (1) 1955 nt
GenBank:BC062846 (1) 1385 nt
GenBank:CO814006 (1) 890 nt
CITATIONS (2)