ZFIN ID: ZDB-TSCRIPT-090929-8644
Transcript Name: cldna-201
Previous Name: cldna-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025944 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025944|OTTDARG00000020670|ZDB-GENE-010328-1 cldna|OTTDARP00000021314 cldna-001 LG_ CR382327.27 Danio rerio protein_coding KNOWN, 1943 bp
CTCTACAGACCAACGAATATTTTTGCTGTCTAATACACCT
GCAATTGTTCCACCATGGTATCAGCAGGGCTGCAGATGGT
GGGTATAGCCCTGGCAGTGATTGGCTGGATTGGGGTTATA
GTGGTTTGCATTCTCCCCATGTGGCAAGTCACTGCTTTTA
TCGGACAGAACATCGTCACGGCGCAGGTTACCTGGGAAGG
AATTTGGATGAGTTGCGTGGTGCAGAGCACCGGACAGATG
CAGTGTAAAGTCTATGACTCCATGTTGGCTCTGAGCTCAG
ATCTTCAAGCCGCTCGAGCTTTGTGTATCATCTCCATCCT
AGTCGGTGTTGTTGGAATCCTCCTCGCGGCGGCGGGAGGA
AAATGCACCACCTGCATTGAAGAAGAACGTGCCAAGGCTA
AAGTCTGCGTTATTTCTGGAGCCATCTTCATCGTGGCTGG
AGTTCTGTGCTTGATTCCTGTTTGCTGGACTGCTAATAAT
ATTATACGCGACTTCTACAACCCTATGACCAACAGCGCGC
AAAAGAGGGAACTCGGAGCGTCGTTGTTTATTGGCTGGGG
GGCTTCGGCGCTGTTGATTATTGGCGGGTCGTTGCTTTGT
GCTAATTGCCCTCCACAAGACCAGTACAAGGCAACGTACA
CCGCTCGATCTGGAGGAACCAAGGGGTATGTCTGAGGAAC
CAAAAGTACTACATTCAAGGAGGATATTGGGTTTTTTATG
TGTATTGGATGCTGGACAGCTTTTGAGGTGGTGTTGTTGT
TGACTATGATCGTGACCGTTATTTTATTTAAAATAACGGT
CGACATATTCAAAAACTGACGGTTGTTGTTTGTTCATGCT
ACTTAAAATGAGCTAAAACAAGTGGAGCCAACTTAATTGT
TTGATGTTCAATCCACTTAAATGTGTAAAAACTATTAAGT
GATCTTAATTCATTCATTCAACTTGTTAAAATCAAATCTA
ATCGTTTTTTTTTTACAGTGTATGAGGCATTGTGAAATAC
AATGAACATGTCAGGGTGCCTGCTTTGAATGGAATAAGTG
TTCAATAAGTGTTTTAAATTGTAAATATAGTTTGTTTTAC
TTGGTATTTACTGTTCTTCAAGTGGTCTTGTGAGTTTCTT
TTTTCTCCTCATCTCAATATTTTGTGGAATGTTTTAAAAC
GCAACTAGGCATGGGACGATAAAGGTTTTCAAGGTATACC
GCGGTTTGGAAAAGTCAAGGTTTTAAAACAATTTTTTAAA
CAATAAATTAAATACATTTTTAATAATTTTTAATAATGTT
TTTTATTTACCTTTTTTAGGACAACAGCAGAAAAGATATC
CAAAGATGCCATTTTTAATTGTAAAAAAAATCATTTTTTT
AAATAAATCAAGACAGCAGATGTAAACAATCATTTATTTT
AAGGATTTATCCTGAAATGTTTACTATTTCAAAATATTTC
AAATGTTTCTTAAACTAAAATATATTGTGTTGAAAAGTGA
AAAATGTGTTTTTTACCCAGGCATTTAAAAAGAATATTTT
TAGAGCAGTAATCACAATAAGCTTTAGTCCAAGGTTATCA
TATTGTCAGAATCTTATACCAGCCCATGCCTACCTGTAAC
CACTGACATCCACAGTAGGAAAAACAAATACTATGGAAGT
CAATGGTTACTAGTTTCCAGCATTCTTTAAAATATCTTCC
TTTGTGTTCAACTGAAGGAAGAAACTCATGTTAAGTGATC
AAGTAGGCTACATGATGACAGGATTTTCATTTTTGAGTGA
ATTGTTTCTTCAATTTTTCTTGTTTTTACTGAGAATCTCT
TCAGAAGTGCTGAAACTGTACATGATTTTTTATTAAAGTT
ATCTTTGATCATATTTTGCTTCAATCCTATTTTGAAATTG
TGACTGATATGCCACAGAACATTTCAAATACAAGAATTTT
ATCGAATAAATCCTTTAAAAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cldna-201 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000025944 (1),  Ensembl_Trans:ENSDART00000102086 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC065445 (1) 1971 nt
GenBank:AF359423 (1) 1876 nt
CITATIONS (2)